- Research
- Open access
- Published:
Understanding the key features of the spontaneous formation of bona fide prions through a novel methodology that enables their swift and consistent generation
Acta Neuropathologica Communications volume 11, Article number: 145 (2023)
Abstract
Among transmissible spongiform encephalopathies or prion diseases affecting humans, sporadic forms such as sporadic Creutzfeldt–Jakob disease are the vast majority. Unlike genetic or acquired forms of the disease, these idiopathic forms occur seemingly due to a random event of spontaneous misfolding of the cellular PrP (PrPC) into the pathogenic isoform (PrPSc). Currently, the molecular mechanisms that trigger and drive this event, which occurs in approximately one individual per million each year, remain completely unknown. Modelling this phenomenon in experimental settings is highly challenging due to its sporadic and rare occurrence. Previous attempts to model spontaneous prion misfolding in vitro have not been fully successful, as the spontaneous formation of prions is infrequent and stochastic, hindering the systematic study of the phenomenon. In this study, we present the first method that consistently induces spontaneous misfolding of recombinant PrP into bona fide prions within hours, providing unprecedented possibilities to investigate the mechanisms underlying sporadic prionopathies. By fine-tuning the Protein Misfolding Shaking Amplification method, which was initially developed to propagate recombinant prions, we have created a methodology that consistently produces spontaneously misfolded recombinant prions in 100% of the cases. Furthermore, this method gives rise to distinct strains and reveals the critical influence of charged surfaces in this process.
Introduction
Sporadic prion disease in humans, in particular sporadic Creutzfeldt–Jakob disease (sCJD), accounts for approximately 85% of currently diagnosed transmissible spongiform encephalopathies (TSE) [27]. With the near eradication of TSE acquired from exogenous sources [72], and the foreseeable reduction of genetic cases resulting from the popularization of genetic counseling and pre-implantation genetic diagnosis [37, 68], sporadic and idiopathic (putatively spontaneous) cases will likely become the focus on the field of these devastating neurodegenerative disorders. However, given the low incidence of sporadic prion disorders in both, humans [27] and other mammals [42], researchers studying the phenomenon of spontaneous misfolding of wild-type prion protein (PrP), probably a stochastic event, suffer from scarcity of suitable models. In fact, the main event underlying genetic and sporadic prion disorders—the conversion of the cellular prion protein (PrPC) into a self-propagating and neurotoxic misfolded isoform (PrPSc)—remains a mystery [58]. Despite some theoretical models have been proposed for PrPSc-induced misfolding of PrPC, the molecular mechanisms driving the formation of the initial PrPSc seed are completely unknown, regardless of the presence or absence of disease-associated mutations, which seemingly increase the propensity of PrPC to misfold spontaneously into PrPSc [3].
To study this event and demonstrate the “protein-only” hypothesis, which states that TSEs are caused by an exclusively proteic pathogen [57], the generation of infectious prions in vitro that mimic the prion misfolding event in a cell-free environment has been pivotal. However, consistently replicating the spontaneous prion formation phenomenon is still challenging. Initially, to demonstrate that PrPSc was formed from PrPC through a nucleation-dependent autocatalytic process, PrPSc-seeded amplification reactions were attempted. These reactions showed low conversion yields [14, 46], but demonstrated strain-specific propagation and replication of interspecies transmission barriers [8, 47]. Conversion efficiency was later improved by using whole brain homogenates as PrPC source and by incorporating cycles of incubation and sonication. This was key for the development of Protein Misfolding Cyclic Amplification (PMCA) [61]. This enhanced system allowed for the definitive demonstration of the nucleation-dependent prion propagation through indefinite serially diluted amplification reactions. PMCA also revealed the importance of yet unknown brain components, later identified as conversion cofactors that were mainly polyanionic molecules promoting conversion [24, 36], and physical processes such as sonication on the prion propagation or misfolding efficiency. Other modifications, such as the addition of beads [32, 38], further improved conversion efficiency. Such an efficient cell-free prion propagation system led to the observation that protease-resistant PrP (PrPres) could be formed in absence of brain-derived PrPSc at low frequency in PMCA, either with minimal components that seem to stimulate spontaneous conversion [23], or with whole brain homogenates, with few modifications in operational parameters [5]. These de novo generated PrPres turned out to be infectious in vivo and showed unique strain properties, establishing the first in vitro prion misfolding systems that could model sporadic prion disorders. Despite the fact that spontaneous misfolding in vitro could be replicated with PrPC from species other than rodents [52], the formation of prions was always an infrequent and stochastic event.
In order to develop a simpler and more versatile in vitro prion propagation system, which could definitively demonstrate the “protein only” hypothesis and facilitate the study of prion misfolding, the use of recombinant PrP (rec-PrP) as substrate was explored. The first report of the spontaneous generation of a synthetic prion in vitro, capable of causing disease in animal models upon intracerebral inoculation, opened the way for the systematic study of this phenomenon [49]. Although this first recombinant prion preparation was not very efficient in inducing misfolding of brain-derived PrPC and subsequent disease, several different attempts followed [21,22,23, 44, 50], each providing valuable information regarding the complex mechanism driving PrP conversion into its pathogenic counterpart. In 2010, Wang and colleagues achieved a major breakthrough in this regard. They reported the generation of the first highly infectious recombinant prion spontaneously, in the absence of any mammalian brain-derived material, with incubation periods similar to those of naturally occurring prions in wild-type animals [71]. Apart from giving definitive support to the “protein only” hypothesis [63], this groundbreaking study demonstrated that infectious recombinant prions with high titer could be generated in vitro spontaneously, an invaluable model to study sporadic TSEs. However, in spite of the conclusive results, the method used for the spontaneous generation of prions still required quite complex equipment and a highly specific skillset, as it relied on PMCA. As with the brain homogenate-based system, the difficulty in controlling parameters and the stochastic nature of spontaneous prion protein misfolding made the process difficult to reproduce, as evidenced by unsuccessful attempts by other laboratories [67, 78].
Thus, despite advances in the generation of recombinant prions in vitro using different procedures and reaction substrates, the molecular mechanisms underlying spontaneous PrP misfolding remain largely unknown. Denaturing agents have been used to favor the formation of recombinant PrPres in vitro, although the resulting amyloids exhibit highly variable properties in terms of in vivo infectivity [21, 49, 50]. With regards to substrate composition, a significant advancement in mimicking spontaneous prion misfolding in vitro comes from the removal of brain homogenates or other brain-derived components from the substrates, which are replaced by chemically defined cofactors. These could help reduce the inherent variability of the process, promote the spontaneous misfolding of the recombinant prion protein into infectious bona fide prions, and unveil some of the conditions and molecular factors required for it [24, 25, 33, 71, 75, 75]. However, the exact role of these polyanionic cofactors remains unclear. Apart from favoring prion propagation in vitro [23, 71], they have been proposed to restrict or direct prion formation towards cofactor-specific conformers or strains [26, 33]. Furthermore, they have also been deemed necessary for the formation of infectious prions from wild-type PrP [10], although for some disease-associated mutant PrP was proven non-essential, as they could be converted in the absence of cofactors [18, 55].
Inspired by the process that led from seeded, brain homogenate-based PMCA to unseeded, recombinant PrP and chemically defined substrate-based PMCA, we have successfully devised a method that consistently generates highly infectious recombinant prions spontaneously in a simple, rapid and efficient way. Through adaptations in substrate composition, bead type and amount and shaking conditions, we have refined the PMSA methodology [30, 31] to induce the spontaneous formation of highly infectious recombinant prions in less than 24 h, exhibiting expected strain variability. Thus, starting from a method highly efficient for recombinant prion propagation from previously generated seeds, we developed a variant that permits de novo prion formation without the need of seeding with pre-formed prions, being the first method for consistent and swift spontaneous prion misfolding in vitro. The simplicity of this system permits an in depth analysis of each variable that influences the process, bringing us closer to understanding the physicochemical parameters that govern the spontaneous formation of prions. Furthermore, its ease of implementation allows for seamless transfer to any laboratory, providing an invaluable tool for answering all the unknowns underlying the development of sporadic TSEs.
In summary, we present a simple and robust methodology that allows to break down the spontaneous prion misfolding phenomenon into its minimal requirements.
Material and methods
Production and purification of recombinant PrP
Bacterial expression and purification of bank vole I109 recombinant PrP (rec-PrP) (amino acids 23-231, based on Genbank accession number AF367624 sequence) was performed as described previously [34]. Briefly, pOPIN E expression vector containing the wild-type I109 bank vole Prnp gene was obtained from genomic DNA of bank vole I109 by PCR using the oligonucleotides 5′ AGGAGATATACCATGAAGAAGCGGCCAAAGCCTGG3′ and 5′ GTGATGGTGATGTTTGGAACTTCTCCCTTCGTAGTA3′ and cloned in the pOPIN E expression vector. E. coli Rosetta™ (DE3) Competent Cells (EMD Millipore) were transformed with the expression vector using standard molecular biology procedures allowing the expression of the recombinant protein in LB broth (Pronadisa) upon Isopropyl β-d-1-thiogalactopyranoside (IPTG) (Gold biotechnology) induction. Purification of the protein was performed with a histidine affinity column (HisTrap FF crude 5 ml, GE Healthcare Amersham) taking advantage of the natural His present in the octapeptide repeat region of PrP. After elution in buffer (20 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole and 2 M guanidine-HCl, pH 8), the quality and purity of protein batches was assessed by BlueSafe (NZYtech) staining after electrophoresis in SDS-PAGE gels (BioRad). Finally, guanidine-HCl was added, to a final concentration of 6 M, for long-term storage of purified protein preparations at − 80 °C. Throughout the work, different batches of protein were produced from the same transformed bacterial colonies and as described above. No independent batches were mixed for the experiments presented.
Preparation of PMSA substrates
Preparation of recombinant bank vole PrP-based in vitro propagation substrates was performed as described previously [30]. Briefly, the purified rec-PrP stored with 6 M of guanidine-HCl was diluted 1:5 in phosphate buffered saline (PBS, Hyclone) and dialyzed against PBS at 1:2000 ratio for 1 h at room temperature. The dialyzed sample was centrifuged at 19,000g for 15 min at 4 °C and the supernatant used for substrate preparation. Rec-PrP concentration in the supernatant was measured (BCA protein assay kit, Thermo Scientific) and adjusted to the working concentration, which, unless otherwise indicated, was of 20 µM to reach a final concentration of 2 µM when diluted in the substrate. The protein, after dialysis and concentration adjustment was mixed with conversion buffer (CB) [34] 1:9, and dextran sulfate sodium salt from Leuconostoc spp. with molecular weights ranging from 6500 to 10,000 (Sigma-Aldrich) was added to a final concentration of 0.5% (w/v). The substrate was aliquoted and stored at − 80 °C until required. From each independent protein batch, several substrate preparations were done, performing independent dialysis for every preparation. Distinct substrate preparations were not mixed for the same experiment.
PMSA reaction for spontaneous misfolding of recombinant PrP and its in vitro propagation
PMSA was initially performed using rec-PrP derived substrates supplemented with dextran sulfate placed in 2 ml tubes with conical bottom and screw cap (Fisherbrand). The reaction temperature was set at 39 °C using either a Thermomixer (Eppendorf) or a Digital shaking Drybath (ThermoScientific) with internal temperature control, and shaking at 700 rpm continuously for 24 h PMSA rounds unless indicated otherwise. At first, 0.1–0.15 g of 1 mm zirconium silicate beads (BioSpec Products, Inc.) were added to the reaction tubes, which were also used in all prion propagation experiments done by serial dilution of the seed (from 10–1 to 10–9). Alternatively, other bead types were used: 1.5 mm diameter steel beads (BioSpec Products, Inc.), 1.5 mm diameter Teflon® beads (Marteau & Lemarie), 1 mm borosilicate beads (Sigma-Aldrich), 1 mm acid-washed glass beads (BioSpec Products, Inc.), 1 mm silicon carbide beads (BioSpec Products, Inc.), and 1 mm zirconium beads (BioSpec Products, Inc.). Once glass beads were chosen for spontaneous misfolding, 0.1–0.4 g of acid-washed 1 mm glass beads were regularly added to each PMSA tubes, unless specified otherwise in experiments in which bead amount was modified. Also, glass beads from different sizes were used in some experiments such as glass beads of 0.15–0.21 mm, 0.21–0.3 mm, 0.42–0.6 mm and 0.7–1.18 mm (all from Sigma-Aldrich), 9–13 µm diameter glass spheres (Sigma-Aldrich) and 0.1–0.2 mm diameter glass beads (Sigma-Aldrich). And in a single experiment, acid washed and unwashed glass beads of ≤ 106 µm were compared (Sigma-Aldrich). In all cases, serial 24 h PMSA rounds were performed at 1:10 to 1:1,000 dilutions using the same bead type and amount at each round.
Loading of prions in zirconium silicate beads for long term storage and use as a seed
Potential recombinant prion strains, characterized by a particular electrophoretic banding pattern after PK digestion, formed in PMSA, were stabilized for long-term storage and posterior propagation or expansion. Stabilization was performed through a slightly modified PMSA procedure. The PMSA product in which each potentially different recombinant prions were first detected was used as seed to inoculate a fresh PMSA substrate containing the same bank vole rec-PrP at 1:10 dilution (seed:substrate). Instead of adding glass beads to the reaction tube, which stimulate spontaneous rec-PrP misfolding, 1 mm diameter zirconium silicate beads (BioSpec Products, Inc.) were used that favour propagation of pre-formed prions. Additionally, these beads show the capacity to bind to prions during the PMSA reaction, getting coated with recombinant prions propagated from the original seed. After 24 h PMSA reaction at 39 °C and 700 rpm, the zirconium silicate beads were recovered from each tube, washed thoroughly with PBS and used as seeds for a second PMSA round in which more non prion-coated zirconium silicate beads were added. 3 to 6 serial 24 h PMSA rounds using fresh-substrate and mixing prion coated and non-coated beads were performed until obtaining the desired amount of recombinant prion-coated beads, which after washing with PBS thoroughly and air drying can be conserved during years at room temperature until their use as seeds. In all cases, conservation of the electrophoretic pattern from the original seed in the prion-coated beads was checked by an additional PMSA round, using 1–5 prion-coated beads as seed. After a 24 h PMSA reaction at 39 °C and 700 rpm, the supernatant was analysed by proteinase K digestion, electrophoresis and total protein staining as detailed below.
Misfolded recombinant PrP detection
PMSA products were transferred from the reaction tubes to clean Eppendorf tubes and digested by adding proteinase K (PK) (Roche) at 25 µg/ml for 1 h at 42 °C in an oven (Nahita). Immediately after digestion, samples were centrifuged at 19,000g at 4 °C for 15 min, the supernatant was discarded and the pellet resuspended and washed with at least 700 µl of PBS (Fisher Bioreagents). After washing, samples were centrifuged for additional 5 min at 19,000g and 4 °C, supernatant discarded, and the pellet resuspended in 15 µl of loading buffer 4 × (NuPage LDS, Invitrogen), previously diluted to 1 × with PBS. PK-resistant PrP detection was done through electrophoresis and total protein staining. For that, PK-digested and concentrated samples in loading buffer were boiled for 10 min at 100 °C and loaded onto 4–12% acrylamide gels (NuPAGE Midi gel, Invitrogen Life Technologies), subjected to electrophoresis for 1 h and 20 min (10 min at 70 V, 10 min at 110 V and 1 h at 150 V) and stained with BlueSafe (NZYTech) for 1 h at room temperature. The same procedure was done for the determination of PK resistance of one of the PMSA products, but using 25, 100, 200, 500, 1000, 2000, 2500 and 3000 µg/ml of PK in a previously aliquoted sample. Additionally, PK digestions were also performed in one case using 25 µg/ml of PK at room temperature and 42 °C, for 6 and 24 h without shaking.
PMCA for the assessment of the potential infectivity of recombinant misfolded PrP
Preparation of PMCA substrate
Perfused whole brains of TgVole 1 × mouse model (see details on the model in the next section), transgenic mice expressing onefold bank vole I109 PrP under the control of the murine PrP promoter in a murine Prnp0/0 background [30], were homogenized at 10% (w/v) in CB with protease inhibitor cocktail (Roche) in a glass potter pestle (Fisher scientific), aliquoted and stored at − 80 °C until required.
Preparation of recombinant seeds
PMSA products containing rec-PrPres were purified prior to their use as seeds for brain homogenate-based PMCA. For that, 6 ml of each PMSA product were ultracentrifuged through a continuous cesium sulfate gradient. This gradient was prepared mixing two Cs2SO4 (Sigma-Aldrich) solutions in PBS, one at 1 M and the other at 1.7 M, with a 15 ml gradient mixer (Sigma-Aldrich), then placed in Thinwall Ultra-Clear, 13.2 ml, centrifuge tubes (Beckman Coulter). PMSA products concentrated through sedimentation to 2 ml were afterwards placed on top of the gradient and submitted to ultracentrifugation, using a SW41 Ti Swinging bucket rotor (Beckman Coulter) and an Optima L-90K ultracentrifuge (Beckman Coulter), at 210,000g for 15 h at 20 °C. Once centrifuged, fractions in which visible precipitated halos were detected, were transferred to 5 ml Eppendorf tubes and diluted with the maximum volume of MilliQ grade water. After centrifugation at 4000g for 30 min, the resuspended pellet was transferred to a 1.5 ml Eppendorf tube and washed with 1 ml of PBS and 15 min centrifugations at 19,000g, repeating the PBS resuspension and centrifugation steps at least two times for each halo. Finally, the purified fractions, resuspended in 25–50 µl of PBS, were used as seed in PMCA reactions.
Brain-PMCA
Brain-PMCA was performed based on modified versions of the PMCA described previously [13, 60, 61], to estimate the potential in vivo infectivity of the recombinant seeds generated prior to bioassays [33]. Using TgVole 1 × brain homogenates as substrates, seeded at 1:10 dilution with the previously purified recombinant seed, a 24 h PMCA was performed in an S-4000 Misonix sonicator with microplate system (Qsonica) with incubation cycles of 30 min followed by sonication pulses of 20 s at 80% power at 38 °C regulated by a circulating water bath. To avoid cross-contamination, all PMCA tubes were sealed with plastic film (Parafilm) prior to introduction in the bath sonicator to prevent accidental opening. Unseeded tubes were also included in the same PMCA round as controls for spontaneous misfolding or cross-contamination.
Bioassay in TgVole 1 × mouse model
TgVole animals, transgenic mice expressing onefold the PrPC from bank voles (Myodes glareolus) bearing isoleucine at position 109 (Genbank accession number AF367624) and generated as detailed in [30], were used for all inoculation experiments shown.
Preparation of inocula
For the inoculation of rec-PrPres, PMSA products were diluted 1:10 in sterile DPBS (Invitrogene), taking care not to include beads of any kind in the final inoculum. The protease-resistant rec-PrP amount, estimated by electrophoresis and total protein staining, was comparable in all samples. To determine specific infectivity of one of the recombinant inocula, the PMSA product was first diluted 1:10 in DPBS, and then further diluted serially from 10–1 to 10–6. Brain-derived inocula or inocula for the second passages were prepared by homogenizing brains of diseased animals at 10% (w/v) in DPBS with protease inhibitor cocktail (PI, Roche) and further diluting the brain homogenate 1:10 in DPBS to reach a final 1% brain homogenate. Finally, glass sphere-based inoculum was prepared using a prion-coated glass sphere suspension (obtained as detailed in section Recombinant prion propagation in PMSA using prion-coated glass spheres as seed of Materials and methods), serially diluted in DPBS from 10–1 to 10–6 and then further diluted 1:10 in PBS as done with the inocula in solution.
Animal inoculation
Groups of 5 to 10 TgVole 1 × animals were inoculated intracerebrally with 20 µl of each inocula into the left cerebral hemisphere using a sterile disposable 27-gauge hypodermic needle while under gaseous anesthesia (Isofluorane, IsoVet®, Braun). The mice were fed ad libitum and were examined twice a week until neurological clinical signs manifested, after which they were examined daily. The presence of prion disease-associated clinical signs was monitored including kyphosis, gait abnormalities, altered coat state, depressed mental state, flattened back, eye discharge, hyperactivity, loss of body condition and incontinence. Clinically affected animals with two or more severe signs, unresponsive mental state or invalidating motor disturbances were culled before neurological impairment compromised their welfare, by exposure to a rising concentration of carbon dioxide. Survival time was calculated as the interval between inoculation and culling or death in days and expressed as days post-inoculation (dpi). Post-mortem, the brain was removed and divided sagittally to be stored at -80 °C and fixed in formalin for posterior biochemical and anatomopathological analysis.
TgVole 1 × mice were obtained from the breeding colonies at CIC bioGUNE (Spain) and were inoculated at the University of Santiago de Compostela and Neiker—Basque Institute for Agricultural Research and Development. All experiments involving animals in Spain adhered to the guidelines included in the Spanish law “Real Decreto 53/2013 de 1 de febrero” on protection of animals used for experimentation and other scientific purposes, which is based on the European Directive 2010/63/UE on Laboratory Animal Protection. The project was approved by the Ethical Committees on Animal Welfare (project codes assigned by the Ethical Committee P-CBG-CBBA-0519, NEIKER-OEBA-2021-003, and 15005/16/006) and performed under their supervision.
Detection of PrPSc in brain and PMCA samples by Western blotting
Presence of protease-resistant, disease-associated misfolded PrP (PrPSc) in brain homogenates or PMCA products was assessed through PK digestion, electrophoresis and immunoblotting. Western blotting was performed as described previously [41]. Briefly, 10% brain homogenates or PMCA products were diluted 1:1 (v/v) in digestion buffer [2% (w/v) Tween-20 (Sigma-Aldrich), 2% (v/v) NP-40 (Sigma-Aldrich) and 5% (w/v) Sarkosyl (Sigma-Aldrich) in PBS]. Proteinase K (Roche) was added to reach a final concentration of 85 µg/ml to each sample and these were incubated at 42 °C for 1 h with moderate shaking, 450 rpm. Digestion was stopped by adding loading buffer (NuPage 4 × Loading Buffer, Invitrogen) 1:3 (v/v) boiling samples for 10 min at 100 °C prior to electrophoresis. Samples were then loaded on 4–12% acrylamide gels (NuPAGE Midi gel Invitrogen Life Technologies), subjected to electrophoresis for approximately 1 h and 20 min and transferred to a PVDF membrane (Trans-Blot Turbo Transfer Pack, Bio-Rad) using the Trans-Blot® TurboTM transfer system (Bio-Rad). After blocking non-specific antibody binding of the membranes by incubation in 5% non-fat milk powder for 1 h at room temperature, monoclonal antibodies D18 (1:5000) [75], 9A2 (1:4000) (Central Veterinary Institute, Wageningen UR) or Sha31 (1:4000) (Bertin Pharma) were added and incubated for 1 h at room temperature, prior to washing. After incubation with peroxidase-conjugated secondary goat anti-human IgG [H + L, Thermo Scientific or anti-mouse antibody (m-IgGκ BP-HRP, Santa Cruz Biotechnology)], membranes were washed again and developed with an enhanced chemiluminescent horseradish peroxidase substrate (West Pico Plus, Thermo Scientific), using a FluorChem Q (Alpha Innotech) or iBright 750 (ThermoScientific) for image acquisition and the software AlphaView (Alpha Innotech) for image processing.
Anatomopathological analysis and immunohistochemistry
Transversal sections of the half-brains fixed with 10% phosphate buffered formalin were performed at the levels of the medulla oblongata, piriform cortex and optic chiasm. Samples were embedded in paraffin-wax after dehydration through increasing alcohol concentrations and xylene. Four-micrometer sections were mounted on glass microscope slides and stained with hematoxylin and eosin for morphological evaluation. Additional sections were mounted in 3-trietoxysilil-propilamine-coated glass microscope slides for immunohistochemistry. Immunohistochemistry (IHC) for detection of PrPres was performed as described previously [62]. Briefly, deparaffinized sections were subjected to epitope unmasking treatments: immersed in formic acid and boiled at low pH (6.15) in a pressure cooker and pre-treated with proteinase K (4 µg/mL, Roche). Endogenous peroxidases were blocked by immersion in a 3% H2O2 in methanol solution. Sections were then incubated overnight with anti-PrP monoclonal antibody 6C2 (1:1000, CVI-Wageningen UR) or exceptionally with 2G11 (1:1000, Bertin Pharma), and subsequently visualized using the Goat anti-mouse EnVision system (DAKO) and 3,3′-diaminobenzidine (Sigma Aldrich) as the chromogen substrate. As a background control, incubation with the primary antibody was omitted. Brain histological lesions (i.e. spongiform change) and PrPres immunolabeling were evaluated under a light microscope by a single pathologist. A semi-quantitative approach was used as previously described [69]. Spongiform lesion and PrPres immunolabeling were separately scored. Fourteen different brain regions were chosen: piriform cortex (Pfc), hippocampus (H), occipital cortex (Oc), temporal cortex (Tc), parietal cortex (Pc), frontal cortex (Fc), striatum (S), thalamus (T), hypothalamus (HT), mesencephalon (M), medulla oblongata (Mobl), cerebellar nuclei (Cm), cerebellar vermis (Cv) and cerebellar cortex (Cc). Scores ranging from (0) absence of spongiosis or immunolabeling: (1) mild, (2) moderate, (3) intense and (4) maximum intensity of lesion or immunolabeling were assigned to each brain area studied. Each area was investigated globally as region for the scoring. Brain profiles were plotted as a function of the anatomical areas which were ordered along the horizontal axis to represent the caudo-rostral axis of the encephalon. Graphs were plotted using Microsoft Office Excel software.
Cryo-electron microscopy
PMSA product containing Ust02 rec-PrPres, approximately 20 ml, was digested with proteinase K at 25 µg/ml and 42 °C for 1 h and purified by ultracentrifugation through a continuous cesium sulfate gradient prior to imaging. After digestion, the sample was concentrated 10 × by sedimentation, reducing the total volume to 2 ml that were washed with Tris-NaCl buffer [10 mM Tris (BioRad) and 100 mM NaCl (Sigma-Aldrich), pH 7.4], centrifuged at 19,000g for 15 min twice. Finally, the pellet was resuspended in 2 ml of Tris-NaCl buffer. The concentrated and PK digested PMSA product was then placed in a Thinwall Ultra-Clear, 13.2 ml, centrifuge tube (Beckman Coulter) on top of a continuous Cs2SO4 gradient ranging from 1 M to 1.7 M and prepared with a gradient mixer (Sigma-Aldrich). After ultracentrifugation, using a SW41 Ti Swinging bucket rotor (Beckman Coulter) at 210,000g for 15 h at 20 °C, fractions in which a visible precipitated halo was detected, was transferred to a 2 ml Eppendorf tube and diluted with the maximum volume of Tris-NaCl buffer. After centrifugation at 19,000g for 15 min, the pellet was washed with 1 ml of Tris-NaCl buffer and centrifuged again, repeating the washing steps three times. Finally, the purified fraction, was resuspended in 50 µl of Tris-NaCl and Amphipol A8-35 (Jena Bioscience) added for a final concentration of 0.02% (V/V). Once sonicated in a cup horn sonicator (S700, Qsonica) at 80% power for 2 min (4 pulses of 30 s), it was loaded in grids as follows. Quantifoil R 2/2 300-mesh copper grids coated with a thin layer of carbon were glow-discharged immediately prior cryo-EM grids vitrification. Grids, loaded with 4 µl of purified Ust02 recombinant prions were prepared by plunge-freezing in liquid ethane using LEICA EM GP2 Vitrobot and cooled with liquid nitrogen. The following settings were used: chamber temperature at 8 °C under > 95% of humidity, blotting time of 30 s with filter paper, and sample drop volume of 4 µl. Vitrified Ust02 rec-PrPSc samples were visualized in a 200 kV JEM-2200FS/CR (JEOL) transmission electron microscope, equipped with an UltraScan 4000 SP cooled slow-scan CCD camera (GATAN).
Scanning electron microscopy (SEM)
To assess whether recombinant PrP and/or misfolded rec-PrP could be bound to the glass beads used in PMSA reactions, glass spheres from 9 to 13 µm of diameter (Sigma-Aldrich) were chosen. Five different samples were prepared for visualization through SEM: Glass spheres washed with distilled water, glass spheres incubated for 1 h at 37 °C and 700 rpm (Thermomixer, Eppendorf) with substrate devoid of rec-PrP, glass spheres incubated in the same conditions with bank vole rec-PrP containing PMSA substrate, glass spheres submitted to PMSA for four 24 h serial rounds, seeded 1:10 in the first one with Ust02 recombinant prions, letting spheres sediment for 15 min after each round and replacing the supernatant for fresh PMSA substrate. After the last PMSA round, glass spheres were harvested and divided in to parts, submitting one half to proteinase K digestion at 5 µg/ml for 1 h at 42 °C and 450 rpm. Both, PK-treated and untreated glass spheres were thoroughly washed with distilled water, and as all the rest of spheres were oven-dried before preparing for visualization. Once all dried, they were sputtered with gold at 25 mA (Emitech K550X, Aname) and analysed by secondary electron emission with a Hitachi S-4000 SEM, operated at 5 kV (SGIker, UPV/EHU).
Mass spectrometry
2 ml of the PMSA product were digested by the addition of PK to a final concentration of 25 µg/ml and incubation at 42 °C for 1 h. After digestion, samples were centrifuged for 30 min at 19,000g, the supernatant was discarded and the pellet was resuspended and washed with 1 ml of PBS. Subsequently, the sample was centrifuged again for 30 min at 19,000g, the supernatant was discarded and the pellet was resuspended in 50 µl Gdn/HCl 6M with 3 pulses of a tip sonicator and incubated for 1 h at 37 °C. After incubation, TFA was added to a final concentration of 1%. Samples (4 µl) were injected into a micro liquid chromatography system (Eksigent Technologies nanoLC 400, SCIEX) coupled to a high-speed Triple TOF 6600 mass spectrometer (SCIEX) with a microflow source, and equipped with a silica-based reversed-phase column ChromXP C18 150 × 0.30 mm, 3 mm particle size and 120 Å pore size (Eksigent, SCIEX). A YMC-TRIART C18 trap column was connected prior to the separating column, online (3 mm particle size and 120 Å pore size, YMC Technologies, Teknokroma). After sample loading and washing with 0.1% formic acid in water to remove Gdn/HCl and other non-peptide components of the sample, the flow was switched onto the analytical column and separation proceeded at a flow rate of 5 μl/min with a solvent system consisting of 0.1% formic acid in water as mobile phase A, and 0.1% formic acid in acetonitrile as mobile phase B. Peptides were separated over 40min with a gradient ranging from 2 to 90% of mobile phase B. Data acquisition was performed in a TripleTOF 6600 System (SCIEX, Foster City, CA) using a Data dependent workflow. Source and interface conditions were the following: ionspray voltage floating (ISVF) 5500 V, curtain gas (CUR) 25, collision energy (CE) 10 556and ion source gas 1 (GS1) 25. The instrument was operated with Analyst TF1.7.1 software (SCIEX, USA). Switching criteria were set to ions greater than mass-to-charge ratio (m/z) 350 and smaller than m/z 1400 with a charge state of 2–5, mass tolerance 250 ppm and an abundance threshold of more than 200 counts (cps). Former target ions were excluded for 15 s. The instrument was automatically calibrated every 4 h using tryptic peptides from PepCalMix as an external calibrant. For data analysis, the sample TIC was opened using the PeakView2.2 software that allows protein reconstruction. The LC–MS Peptide Reconstruct feature uses a peak finding algorithm to identify groups of peaks that form isotope series and charge series. Protein deconvolution was carried out between 800 to 20,000 Da.
Siliconization of glass beads for PMSA
Siliconization involves placing a thin layer of dimethyldichlorosilane onto a glass surface, making it extremely hydrophobic and preventing binding of many biomolecules. This procedure was used to siliconize glass beads prior to their use in PMSA. A 2% (V/V) dimethyldichlorosilane (Sigma-Aldrich) solution was prepared in chloroform (Sigma-Aldrich), and glass beads were submerged in it, moving them around using polypropylene forceps for few minutes. After removing the beads from the solution, the excess of solution was drained and beads were placed in a paper towel for air drying overnight. Finally, the siliconized glass beads were baked for two hours in an oven at 60 °C, washed thoroughly with MilliQ grade water and allowed to air dry prior to their use in PMSA. This was performed at the usual conditions of 39 °C and continuous shaking at 700 rpm for 24 h, with approximately 50 siliconized glass beads of 1 mm diameter per tube, and the control reaction was done with the same amount of non-siliconized glass beads of the same batch.
PMSA in glass tube versus plastic tube with and without glass beads
To evaluate if a quiescent glass surface could be enough to promote spontaneous rec-PrP misfolding, PMSA was performed in glass tubes (9 mm short thread glass vial, Fisherbrand, Fisher Scientific), complemented or with glass beads. The internal glass surface of the tube was of approximately 125π mm2, so the amount of beads added to plastic 2 ml Eppendorf tubes that served as control was of 0.35 g, representing also 125π mm2. The PMSA was performed with the glass tube without and with 0.35 g of 1 mm diameter glass beads and with the usual plastic tubes without and with the same amount of glass beads. All of them were submitted to a 24 h PMSA in standard conditions of 39 °C and continuous shaking at 700 rpm.
Immobilization of glass beads in plastic resin for PMSA
To assess whether glass bead movement plays a role in spontaneous rec-PrP misfolding, 1 mm diameter glass beads were embedded in a plastic resin that allowed most of the surface of the beads to be solvent exposed. Fragments of the resin, adding up to 50 embedded glass beads, were spiked to four PMSA reaction tubes and a positive control was included in duplicate with the same number of free glass beads of the same batch. Additionally, two tubes with no beads were added also as negative control. All tubes were submitted to a single 24 h PMSA round in standard conditions.
Evaluation of rec-PrP adsorption to glass beads
To determine rec-PrP adsorption to glass beads and characterize the kinetics of the phenomenon, triplicates of two tubes were prepared with recombinant bank vole protein dialyzed and diluted in PBS as for the preparation of PMSA substrates, one of them without glass beads and the other with 0.1 g of 0.1 mm diameter glass beads (Sigma Aldrich), which corresponds to 500π mm2 of glass surface. Both tubes were incubated in a rotary shaker for 24 h, retrieving aliquots of the supernatant from each tube at time points 0, 15 min, 30 min, 45 min, 1 h, 2 h, 6 h and 24 h. rec-PrP concentration in the supernatant at each time point was measured by BCA protein assay kit (ThermoScientific), following the instructions from the manufacturer.
Recombinant prion propagation in PMSA using prion-coated glass spheres as seed
To assess the propagation capacity and potential infectivity of recombinant prions adsorbed to glass beads, 9–13 µm diameter clean glass spheres (Sigma Aldrich) were first coated with Ust02 prions. For that, 0.2 g of spheres were added to a PMSA substrate that was seeded with a PMSA product containing Ust02 prions at 1:10 dilution. After 24 h of PMSA at 39 °C and continuous shaking at 700 rpm, supernatant was removed and fresh PMSA substrate and 0.2 g of clean glass spheres were added to the tube with already prion-coated spheres. Three PMSA rounds were performed in total, getting a total of 0.6 g of Ust02 prion-coated spheres. After the final round, the supernatant was taken and stored and glass spheres were washed 3 times with PBS and two additional times with MilliQ-grade water to finally air dry the spheres to be used as seed.
To assess in vitro propagation capacity of prion-coated spheres in comparison to the same prions in solution, dried prion-coated spheres were resuspended in 400 µl of PBS to be used as stock suspension. From this stock 1:10 serial dilutions were performed from 10–1 to 10–8 on tubes containing PMSA substrate complemented with 3 zirconium silicate beads of 1 mm diameter (BioSpec Products, Inc.). Similarly, the supernatant obtained from the prion-coated glass sphere production process was serially diluted 1:10 (from 10–1 to 10–8) in the same substrate complemented with zirconium silicate beads, and both sets of tubes were submitted to a 24 h PMSA round at 39 °C and continuous shaking at 700 rpm. Results were evaluated as previously, through proteinase K digestion, electrophoresis and total protein staining. Additionally, to confirm prion coating of glass spheres, the suspension prepared previously was treated with proteinase K as the inocula in solution and then mixed with loading buffer (NuPage 4 × , Invitrogene) to release adsorbed prions, including an undigested suspension as control. These samples were also submitted to electrophoresis and total protein staining as described above.
Determination of the dynamics of spontaneous misfolding and prion propagation in PMSA
To assess if spontaneous misfolding of rec-PrP is a frequent or an infrequent event, the time required for obtaining detectable levels of rec-PrPres was measured in an unseeded PMSA reaction using 30 glass beads of 1 mm diameter and in two seeded PMSA reactions: one containing just 1 prion loaded glass bead (obtained from a 24 h PMSA in which Ust02 prion strain was generated) and the other with 30 prion loaded glass beads from the same source as the previous one. All reactions were performed with standard PMSA conditions, 39 °C and 700 rpm of continuous shaking, including 4 replicates of each condition. Aliquots from the supernatant of each tube were collected every 30 min during the first hour and a half, and every 90 min from there. Rec-PrPres presence was evaluated as detailed above by digestion with proteinase K, electrophoresis and total protein staining.
Results
A highly efficient technique to propagate bona fide prions reveals spontaneous stochastic protein misfolding events
Recently, we presented a new method for the efficient and indefinite propagation of recombinant infectious prions in vitro called PMSA [30]. This easily scalable method is able to propagate recombinant bona fide prions with extraordinary efficiency in a chemically defined environment and is aimed to obtain large amounts of prion samples for structural studies. However, as most techniques for in vitro protein misfolding that favor aggregate formation of highly amyloidogenic proteins, it presents an intrinsic issue associated with the stochastic nature of the prion misfolding event. Likely related to its high conversion efficiency, PMSA gave raise to spontaneous, low frequency, stochastic misfolding of the recombinant bank vole prion protein used as substrate into protease-resistant isoforms (rec-PrPres), mainly in tubes with highly diluted seeds or unseeded.
Intrigued by the spontaneous formation of potentially bona fide recombinant prions, we decided to assess the frequency of occurrence of this phenomenon and determine if the PMSA could serve for the spontaneous formation of prions. For that, 20 independent and unseeded PMSA reactions were set up, each submitted to three serial rounds of 24 h. Rec-PrPres from bank vole with an electrophoretic migration pattern resembling that of previously propagated recombinant prions was found in just one tube at the third round of PMSA (Additional file 1: Fig. S1). The frequency of potential spontaneous misfolding was 0 in the first and second PMSA rounds and 5% in the third. To avoid any possible bias due to differential recognition of proteolytic fragments by primary antibodies, all samples were concentrated approximately 50 times to improve the detection limit and were visualized by total protein staining.
Only a certain type of beads efficiently drives spontaneous recombinant PrP misfolding
Given the simplicity of the PMSA and the limited number of elements comprising the propagation system, we decided to further explore some of the individual components and their contribution to the spontaneous formation of rec-PrPres. One of the most critical elements for the high efficiency of prion propagation by PMSA is the presence of 1 mm zirconium silicate beads, which seemingly enhance seed-induced recombinant PrP misfolding [30]. Consequently, we tested whether the spontaneous misfolding frequency could be modified using beads made of different materials. With this purpose in mind, 1 mm beads made of 7 different materials were tested (50–70 beads per tube) and their propensity to give rise to PrPres determined, as well as that of a negative control without beads, over three serial 24 h rounds of PMSA. Taking advantage of the large reaction volumes accommodated by PMSA, misfolded and PK-resistant PrP was visualized through total protein staining (Fig. 1).
Interestingly, while zirconium and zirconium silicate beads did not cause spontaneous formation of rec-PrPres in agreement with the low frequency showed in the previous study (5% in third round), glass beads showed induction of spontaneous misfolding, with rec-PrPres detected from the first round of PMSA.
A highly reproducible and truly spontaneous protein misfolding event
The unexpected behavior of the recombinant bank vole PrP when subjected to PMSA with glass beads, dramatically different than when using other bead materials, required further confirmation. Moreover, the products of spontaneous misfolding obtained in such highly efficient prion propagation systems, arise doubts on their spontaneous nature regarding the potential occurrence of cross-contamination with seeds previously handled within the same laboratory. To address these concerns, three independent rec-PrP batches were produced, substrates were prepared, and newly opened glass beads were added in a prion-free laboratory. Given the simplicity of the system, prion-free shaking equipment could be used, not only completely eliminating the risk of cross-contamination but also showing that this procedure can be easily performed anywhere. Nonetheless, additional negative controls were included to discard any chance of cross-contamination, using one of the substrate replicates with zirconia silicate beads instead of glass beads. Thus, the different batches were submitted to the same PMSA procedure in two independent experiments. The results, shown in Additional file 1: Fig. S2, consistently confirm the effectiveness of the method to induce truly spontaneous rec-PrP misfolding. Notably, rec-PrPres detected in 100% of the tubes from the first round of PMSA, being the negative control with zirconia silicate beads negative in all rounds.
Recombinant PrP spontaneously misfolded by PMSA exhibits the key biochemical hallmarks of bona fide prions
The self-propagation capacity and protease resistance are distinctive features of bona fide prions that can be rapidly assessed in vitro. Therefore, to determine if the spontaneously generated misfolded and partially protease-resistant rec-PrP produced by PMSA are indeed bona fide prions, we assessed their self-propagation capacity and the relative resistance to proteinase K (PK). In addition, the spontaneously generated misfolded rec-PrP was used as a seed in PMCA to examine whether these preparations could propagate on a brain homogenate substrate containing brain-derived PrPC, indicating their potential in vivo infectivity.
The self-propagation capacity was evaluated first through serial PMSA passages, seeding the PMSA substrate at 1:10 dilution of the spontaneously generated product, which was then subjected to a 24 h PMSA. For the following passages, the product from the previous PMSA round was again diluted 1:10 in fresh substrate and subjected to another 24 h PMSA. The results demonstrated stable and successful propagation of the spontaneously generated rec-PrPres, retaining its original electrophoretic migration profile after PK digestion (Fig. 2A). Similarly, when the same seed was subjected to a single PMSA round of 24 h at serial dilutions ranging from 10–1 to 10–9 in fresh PMSA substrate, detectable rec-PrPres was observed up to a dilution of 10–7 (Fig. 2B), indicating a high efficiency on in vitro propagation.
The proteinase K resistance of the spontaneously generated seed was assessed by digesting the product of serial PMSA propagation with increasing concentrations of PK at two different temperatures. As shown in Fig. 2C, this rec-PrPres displayed high resistance to PK, withstanding up to 3000 µg/ml at RT and up to 2500 µg/ml at 42 °C, thus fulfilling another characteristic shared by most of the brain-derived prions. Additionally, the same sample was digested at 100 µg/ml of PK for 24 h, further confirming the remarkable resistance of PMSA products to proteolytic digestion (Fig. 2D). In fact, when compared to other well-known brain-derived prion strains, it exhibited equal or higher resistance to protease digestion (Additional file 1: Fig. S3).
Finally, PMCA with brain homogenate as a substrate was conducted. This experimental approach not only further confirms the bona fide prion behavior of the recombinant preparation but also suggests its potential infectivity in vivo. This is supported by the observed correlation between the ability of the rec-PrPres to induce PrPC misfolding in vitro and their in vivo infectivity [30, 33]. As shown in Fig. 2E, the spontaneously generated and purified rec-PrPres effectively induced misfolding of bank vole PrPC in PMCA, at least up to dilution 10–2. Interestingly, purification through density gradient and ultracentrifugation yielded two distinct fractions (referred to as visible protein halos h1 and h2) with indistinguishable electrophoretic patterns after proteinase K digestion. These fractions exhibited similar capabilities in terms of seeding brain-derived PrPC in vitro as demonstrated in Fig. 2E.
Distinct electrophoretic migration profiles point towards the spontaneous formation of different conformers
Distinct electrophoretic migration profiles were observed during multiple unseeded PMSA experiments. These variations in migration profiles of rec-PrPres, evident after proteinase K digestion, suggest the presence of different proteolytic fragments and, consequently, the existence of diverse misfolded PrP conformers. To further explore this phenomenon, a comprehensive analysis was conducted on the electrophoretic migration patterns obtained from all previous unseeded PMSA experiments. These patterns were carefully examined and classified according to the size and relative intensities of visible fragments following total protein staining. The identified distinct migration profiles are depicted in Fig. 3.
The repeated occurrence of four distinct profiles during spontaneous in vitro misfolding suggests the presence of different conformers, possibly representing distinct strains. These conformers exhibit varying levels of protease resistance and demonstrate the ability to self-propagate when used as seeds at a 1:1000 dilution in PMSA, while maintaining their characteristic electrophoretic migration profiles (Additional file 1: Fig. S4A to 4C).
To enable long-term storage at room temperature, the distinct conformers were loaded into zirconium silicate beads. These beads, after thorough washing and drying, can be used as reaction seeds to further propagation, even after years of storage. In addition, as the previously tested rec-PrPres, these potentially different conformers were able to induce misfolding of brain-derived PrPC in PMCA, pointing towards infectivity in vivo (Additional file 1: Fig. S4D). Notably, the pre-purification of the recombinant seeds through density gradient and ultracentrifugation resulted in two fractions with indistinguishable banding pattern following proteinase PK digestion, highlighting their comparable seeding capacities in all cases.
Spontaneous misfolding in PMSA consistently generates bona fide prions that are infectious in vivo and exhibit distinct strain features
To confirm the prion nature of the distinct conformers repeatedly obtained spontaneously in PMSA, intracerebral inoculations were performed on TgVole mice expressing 1 × the PrPC from bank voles using the potentially different recombinant PMSA products.
The fact that 100% of the inoculated animals succumbed to neurological disease (Table 1) clearly confirms the bona fide prion nature of the recombinant misfolded PrPres. This was further confirmed through the detection of PrPSc in the brains of all inoculated animals by Western blotting (Fig. 4A), and their anatomopathological analysis (Fig. 4B), which revealed the presence of vacuolation and PrPres deposits. Furthermore, a second passage from TgVole 1 × animals at the terminal stage, after inoculation with each distinct recombinant preparation, demonstrated the transmissibility of the prion disease induced by all of them (Table 1).
A comprehensive histopathological analysis of TgVole 1 × animals inoculated with the recombinant preparations, both directly and upon secondary transmission, revealed distinct lesion profiles (Additional file 1: Fig. S6).
Matching their similarity in terms of proteolytic fragments after proteinase K digestion, the preparations named Ust01 and Ust02 exhibited similar lesion patterns in the first passage. Spongiform changes were predominantly observed in the striatum, accompanied by mild affectation of the medulla oblongata. However, PrPres deposits were also observed in regions without spongiosis, including thalamus, hypothalamus, mesencephalon, medulla oblongata, neocortex, pyriform cortex, and particularly intense in the hippocampus and cerebellar cortex. These deposits consisted in extracellular plaques of varying sizes, as well as granular deposits in the neuropil, occasionally displaying a stellate pattern associated with glial cells. Notably, florid plaques were observed in the striatum. Despite their resemblance in the first passage, these two recombinant prions exhibited striking differences upon secondary transmission. While Ust01 displayed an irregular pattern with some animals showing a vacuolation pattern similar to the first passage, others do not show striatal lesions. Florid PrPres plaques and cerebellar white matter plaques were consistently present in all animals, suggesting a potential mixture of strains or instability of the misfolded PrP in the original recombinant preparation, which may have been further selected or evolved during passages. A similar trend was observed with Ust06, which initially caused mild spongiosis in the striatum, brain stem, and cerebellar nuclei along with evident gliosis in the hippocampus. In terms of PrPres deposits, animals showed a granular pattern in the neuropil and intraneuronal deposits. In the second passage, intense spongiosis was detected in the piriform cortex, hippocampus, the ventral aspect of the occipital cortex, and the neocortex, which was absent in the first passage. Mild brain stem spongiosis and affectation of cerebellar hemispheres and vermis were preserved, unlike the observations in the cerebellar nuclei. PrPres deposits appeared as punctate granular deposits in the same areas as the first passages. In contrast, Ust09 showed a highly conserved lesion profile between the first and second passage. Mild spongiosis affecting the striatum, brain stem, and cerebellar nuclei was observed in both groups, along with granular PrPres deposits in the neuropil and intraneuronal deposits, similar to what was seen in animals inoculated with Ust06 on first passage but without involvement of the hippocampus. In summary, all four recombinant preparations displayed distinct biological features, with potential adaptation of some strains upon secondary transmission. This suggests the possibility of strain evolution in vivo or to the presence of mixtures in the original preparation, which may have undergone further selection during in vivo transmission.
Recombinant prions generated spontaneously in PMSA show high specific infectivity comparable to those of brain-derived prions
The generation of protein aggregates in vitro that exhibit features of bona fide prions, particularly their capacity to induce disease in vivo, often arises concerns about whether the entire preparation consists of infectious prions or if they are merely a minor component within a heterogeneous mixture, with the majority being non-prion amyloids. In order to address this issue, a titration experiment was conducted on one of the PMSA products, the strain named Ust02. This experiment aimed to determine the specific infectivity of the preparation intracerebrally inoculating serial dilutions of the PMSA product into a susceptible model, TgVole 1 × .
Calculations on the specific infectivity of the strain Ust02, using data from Additional file 1: Table S1 (also represented in Additional file 1: Fig. S7) in agreement with the Spearman-Karber method [59], reveal an infectious titer of 4.16·105 LD50/µg of recombinant PrP. Compared to that of a brain-derived strain inoculated in the same model (data and calculation provided in Supplementary information section and Additional file 1: Table S2), this spontaneous recombinant prion preparation exhibits an 80-fold lower specific infectivity than CWD-vole strain, suggesting a high content on infectious prions, not far from that accumulated in the brain of infected animals at terminal stage of disease.
Electron microscopy and mass spectrometry analysis of Ust02 recombinant prion strain confirms its fibrillary structure and gain insights into the structural arrangement of recombinant prions
To elucidate the ultrastructural features and potential differences between spontaneously formed recombinant prions and brain-derived prions, the Ust02 strain was imaged with cryo-electron microscopy after proteinase K digestion and purification through density gradient and ultracentrifugation. This analysis aimed to assess if the recombinant prions generated in PMSA acquire the expected fibrillary architecture and arrange themselves as prion rods. In addition, mass spectrometry analysis was employed to examine proteolytic rec-PrPres fragments from Ust02 providing valuable information about the structural arrangement of these prions through the identification of sites exposed to protease digestion.
Upon purification through a density gradient, the PK-digested PMSA preparation was found to be present in a single fraction, presenting as a discernible halo. This fraction was collected, washed, concentrated, and subsequently visualized using cryo-electron microscopy. As shown in Fig. 5, PK-digested and purified Ust02 strain forms elongated, straight fibrils that tend to cluster together in laterally associated fibril bundles. These observations closely resembled the fibrillary structures observed in other prions purified from brains or obtained from field isolates.
Regarding proteolytic fragments identified by mass-spectrometry, the main bands visible in acrylamide electrophoretic gels through total protein staining were identified (Additional file 1: Fig. S8). The upper band, migrating at approximately 16 kDa, corresponds to Q98-S231 residues of the bank vole PrP. The central band, which is the most intense at around 10 kDa corresponds to the N153/M154-S231 C-terminal fragment. Immediately bellow, another band corresponds to the fragment spanning from residues V161/Y163 to residue S231. Furthermore, several low molecular weight fragments were also identified, aligning with the signal observed in the gels around 5 kDa, mainly corresponding to N-terminal fragments spanning from 96,97,98,99 to 150,153. The most parsimonious interpretation of this patterns is a main cleavage around position 97/98, a secondary “internal cleavage” around position 153, and second, minor internal cleavage around position 161/163.
The extension of the glass surface is critical for the spontaneous misfolding
Once developed, this simple and robust method provides the opportunity to potentially unravel the key physicochemical factors that promote the spontaneous misfolding of PrP into bona fide prions. The changes applied to the previously developed PMSA were analyzed, resulting in highly efficient prion propagation but rare spontaneous misfolding. Previous results using different bead materials clearly demonstrated the critical role of glass beads in promoting spontaneous misfolding. However, it remained unclear whether this effect was determined by bead size, shape, quantity, or their movement. To further investigate the contribution of glass beads to the spontaneous misfolding event, we conducted tests using different amounts of beads with distinct sizes to assess the propensity for spontaneous prion formation.
The comparison between 1 and 0.1 mm diameter beads, with approximately 30 mg of each type per tube, showed differences in the emergence of spontaneously misfolded PrP over three serial PMSA rounds. Tubes containing 1 mm beads (with a surface area of 10-20π mm2) required at least two serial PMSA rounds for the formation of rec-PrPres, while 0.1 mm beads (with a surface area of around 1000–2000π mm2) induced spontaneous rec-PrPres formation in 100% of the tubes from the first round (Fig. 6A). This result contrasts with previous experiments where 1 mm glass beads consistently induced misfolding from the first PMSA round. However, this discrepancy led us to pay attention to the number of beads within the reaction tube, as the higher amount used in the initial experimental settings (e.g. Fig. 1 and Additional file 1: Fig. S2, where 0.1–0.15 g of 1 mm glass beads were used) may play a critical role in the available glass surface. To definitively assess if the critical parameter related to glass beads is the amount or the available surface, PMSA reactions with 0, 1, 2, 4, 8, 16, 32 and 64 beads of 1 mm diameter were performed. As shown in Fig. 6B, maximum induction of spontaneous rec-PrP misfolding was achieved with 8 or more beads, and a plateau of maximum frequency was observed at the first PMSA round with 8–16 beads (approximately 8–16π mm2). Lower amounts of beads resulted in reduced spontaneous misfolding frequency. This experiment confirmed the requirement of a minimum amount of glass beads or minimum available glass surface for the spontaneous misfolding in our system. In tubes without glass beads or with only one bead, no rec-PrPres was observed even after three serial PMSA rounds. In addition, to further demonstrate that glass size is not critical as long as a minimum amount or, more likely, a minimum surface is used, two different batches of 4 types of glass beads ranging from 0.15–0.21 to 0.7–1.18 mm diameter were added in similar volumes (with surfaces ranging approximately from 50 to 100π mm2) to the same PMSA substrate and subjected to three serial 24 h PMSA rounds. As shown in Additional file 1: Fig. S9, regardless of bead size all PMSA products exhibited rec-PrPres from the first round, indicating that as long as the bead surface exceeded 20π mm2, specific size or number of beads did not play a critical role. These results suggest that the available glass surface is likely the determining factor for the spontaneous misfolding of rec-PrP.
This was convincingly demonstrated by using glass beads of two different sizes (0.2 and 1 mm diameter) to achieve equivalent surface areas, regardless of the quantity of each bead type. Samples with varying glass surfaces were subjected to PMSA, and it was observed that the maximum efficacy of spontaneous misfolding occurred in tubes with surfaces ranging from 100π to at least 250π mm2, irrespective of bead size (Fig. 6C). However, due to technical limitations—inclusion of required 1 mm diameter beads to achieve 1000π or 2500π mm2 surface precluded their free movement inside the reaction tube—no conclusive results could be obtained with the largest beads at the higher surface areas. However, the use of 0.2 mm beads allowed evaluation of the effect of largest surfaces, revealing an optimal surface range from 100π to 1000π mm2, with a reduction in efficiency detected above 1000π mm2. These findings indicate that while a minimum surface is required for efficient induction of spontaneous misfolding, there may also be an upper limit, suggesting that excessive available surface is detrimental, likely due to the depletion of all soluble rec-PrP from the substrate.
The significance of available glass surface in promoting spontaneous prion misfolding was further demonstrated by observing different efficiencies with distinct glass bead batches, some of which were acid washed while others were not. Visually observable differences in the appearance and color of the beads raised suspicions regarding potential variations in the bead fabrication processes, which could explain the divergent results obtained with different batches. Information provided by manufacturer indicated that acid was part of the production process. In light of this, we decided to investigate the effect of acid-washed glass beads versus no acid-washed beads in PMSA (Additional file 1: Fig. S10A). The results showed that the rec-PrPres formation occurred only with beads treated with acid, indicating that surface impurities can also impact the efficiency of spontaneous misfolding. Furthermore, when the glass bead surface was coated with dimethyldichlorosilane (a process known as siliconization), the same beads that previously induced misfolding lost their capacity to promote spontaneous misfolding (Additional file 1: Fig. S10B). Hence, in addition to the amount or surface area of glass beads, the quality and purity of their surface are determinant to induce consistent spontaneous PrP misfolding in vitro.
The highly efficient spontaneous misfolding also requires the movement or interaction of the glass beads
While the critical role of a minimum available glass bead surface on spontaneous PrP misfolding in PMSA has been demonstrated, the contribution of continuous and vigorous shaking remains unknown. Since PMSA with other bead types does not give raise to consistent spontaneous PrP misfolding, it is clear that shaking and bead movement alone are not sufficient. However, whether it is necessary in conjunction with an appropriate glass surface needed to be assessed to better understand the critical factors inducing spontaneous prion misfolding. For that, we conducted an experiment replacing the glass surface provided by beads with the internal surface of a glass tube. The positive control consisted of a plastic tube with 1 mm glass beads (total surface of approximately 125π mm2), while additional controls included a plastic tube without beads and a glass tube with the same number of beads. All tubes were submitted to a single 24 h PMSA round. The results shown in Fig. 7A clearly demonstrate that rec-PrPres was formed spontaneously only in the presence of glass beads, even though the internal glass surface of the tube was equivalent to that provided by glass beads in the plastic tube. This indicates that both, the availability of a minimum glass surface and the presence of shaking, bead movement, or clashes are necessary for spontaneous prion formation in PMSA. It suggests that the surface energy of glass and other physical factor related to glass bead movement or clashes may play a critical role [6, 7, 16]. Furthermore, the immobilization of glass beads in a plastic resin also resulted in a lack of spontaneous rec-PrPres formation (Fig. 7B), confirming the importance of bead movement in conjunction with the minimum glass surface.
The interaction between recombinant PrP and the surface of glass beads is essential for inducing spontaneous misfolding
If a glass surface and some form of bead movement or clashing are necessary, some interaction between the protein and the glass is assumable. Nonetheless, to gain insight on the mechanisms underlying the spontaneous prion misfolding in PMSA, the binding of rec-PrP to the glass beads needed to be demonstrated. For that, the amount of soluble rec-PrP in the substrate was monitored during a 24 h incubation with 1 mm diameter glass beads (providing a total surface of 500π mm2) compared to a control without beads. Electrophoresis and total protein staining of the supernatant revealed a gradual decrease in soluble or free rec-PrP over time in the presence of beads, confirming the binding of rec-PrP to the glass surface, likely through electrostatic interactions (Additional file 1: Fig. S11). This binding was further confirmed by scanning electron microscopy (SEM), which showed a uniform coating of the glass spheres surface that resisted extensive washing, indicating a strong and likely long-lasting binding (Fig. 8).
Spontaneously formed rec-PrP res is strongly associated to glass beads, which can act as seeds in vitro and are highly infectious in vivo
In the light of the binding of rec-PrP to the glass surface, we wondered if rec-PrPres could also be localized in the surface of the beads. For that, we first recovered the glass beads from a PMSA tube in which spontaneous rec-PrPres formation had occurred in a 24 h PMSA reaction. The beads obtained from this tube were extensively washed to eliminate rec-PrPres from the supernatant that could be weakly bound to the bead surface and afterwards used as seed in a new PMSA reaction with fresh substrate. Negative controls consisted of the same number of beads that were not subjected to PMSA, ensuring that any detected rec-PrPres could be attributed to seeding rather than newly generated rec-PrPres. As shown in Fig. 9, beads presumably coated with rec-PrPres exhibited seeding activity in PMSA, confirming their rec-PrPres coating. Moreover, SEM images revealed a fibrillary material coating the glass beads after an unseeded PMSA reaction. This material resisted proteinase K treatment and remained firmly attached to the beads even after extensive washing (Fig. 10), suggesting a strong association between spontaneous prion formation and the glass surface. The presence of rec-PrPres coating of beads was further proven in vivo by inoculation of glass spheres that had previously undergone PMSA. Immunohistochemical analysis of the mouse encephalon 72 h after intracerebral inoculation showed clearly that there is PrPres surrounding the spheres (Additional file 1: Fig. S12). In addition, to demonstrate the capacity of beads to harbor a high load of recombinant prions, glass spheres (9–13 µm diameter) previously used in PMSA were serially diluted and intracerebrally inoculated in TgVole mice. This experiment allowed for the calculation of specific infectivity in glass spheres (data provided in Supplementary material section and Additional file 1: Table S3) compared to direct inoculation of the PMSA supernatant. The specific infectivity is glass spheres was determined to be 3.23·103 LD50/µg of PrP, lower than that of the liquid inoculum, suggesting that prion attachment to glass spheres could reduce their spreading capacity or, alternatively, that adsorption is limited and a majority of infectious PrPres is released into the supernatant during PMSA.
Exploring the dynamics of spontaneous misfolding and prion propagation in PMSA
The efficiency and consistent formation of spontaneous recombinant prions in PMSA within 24 h or less, along with the high yield of seeded protein misfolding using zirconia-silica beads [30], poses relevant questions regarding the frequency of spontaneous misfolding events. It raises the important question of whether prion propagation is the primary event following the unusual formation of a single or a few misfolding nuclei, or if spontaneous misfolding occurs frequently and propagation is merely a secondary event resulting from the formation of multiple spontaneously misfolded nuclei.
In the context of PMSA, two distinct time intervals might be considered: ts, which represents the time required for the spontaneous misfolding of a single propagation nucleus or a bona fide misfolded rec-PrP particle; and tp, which denotes the time needed for the propagation of rec-PrPres. Given that the presence of glass beads facilitates spontaneous misfolding, the minimum duration of PMSA necessary for detectable rec-PrPres formation through electrophoresis and total protein staining, referred to as tPMSA, can be defined as tPMSA = ts + tp for a fixed number of beads. Based on these considerations, two scenarios are possible during an unseeded PMSA, as illustrated in Additional file 1: Fig. S13A. The first scenario suggests that the spontaneous misfolding event occurs rapidly and frequently, resulting in a short ts. These misfolding events would happen predominantly in the initial stages of the PMSA reaction, overlapping with the propagation process or tp. Consequently, there would be a slow and initially undetectable increase in the amount of rec-PrPres until reaching tPMSA, at which point the rec-PrPres amount turns sufficient to be detectable by total protein staining. Alternatively, in the second scenario represented, spontaneous misfolding would be infrequent and occur at a slower rate resulting in a longer ts. Unlike the first scenario, these would not be a steady increase in rec-PrPres during ts. However, once the initial nuclei are formed (after ts), the propagation process would be very rapid, with a short tp. This phase would involve a rapid and significant increase in rec-PrPres until reaching detectable amounts.
If we consider that one prion-loaded bead represents the minimum amount of spontaneously misfolded rec-PrPres that can be retrieved from a PMSA reaction, we can define the following parameters: ts as the time required to generate one spontaneously loaded bead; tp1 as the time needed for that single rec-PrPres-containing bead to propagate in PMSA until it reaches detectable amounts by total protein staining, and tpn as the time required for n rec-PrPres-loaded beads to propagate until they reach detectable amounts. In this case, if tp1 < tPMSA, we could conclude that spontaneous misfolding is an infrequent event. When the time required for the propagation of a single nucleus (or single rec-PrPres-loaded bead) is shorter than the time required to obtain detectable rec-PrPres in the reaction, it suggests that all the detectable product at the end of the reaction originates from the propagation of that single seed rather than from multiple nuclei. On the contrary, if tp1 or tpn > tPMSA, we could conclude that the spontaneous misfolding is a fast and frequent event in PMSA. When the time required for propagation, either from a single or multiple nuclei, is longer than the time needed to obtain detectable rec-PrPres amounts in an unseeded PMSA reaction, it implies that the rec-PrPres observed at the end of the PMSA primarily originates from spontaneous formation and undergoes a subsequent, much slower propagation from each of the generated nuclei.
To assess this, we analyzed the propagation times of 1 versus 30 rec-PrPres-loaded 1 mm glass beads in PMSA until detectable rec-PrPres was obtained through PK digestion, electrophoresis, and total protein staining (tp1 and tp30). In parallel, we evaluated the time necessary to detect rec-PrPres in PMSA when using 30 non rec-PrPres-loaded 1 mm diameter glass beads (tPMSA). As shown in Additional file 1: Fig. S13B, the experimental procedure involved sampling at 30 min intervals for the propagation PMSA assay and at 90 min intervals for the unseeded PMSA. The presence of rec-PrPres was analyzed by PK digestion, electrophoresis, and total protein staining. According to the study, tp1 and tp30 were both ≤ 0.5 h, indicating that the propagation of recombinant prion from rec-PrPres loaded beads is an extraordinarily rapid process. In contrast, in the unseeded PMSA using the same 30 unloaded glass beads, the minimum reaction time required to detect rec-PrPres (tPMSA) was ≤ 3 h. From these findings, we can infer that the spontaneous formation of rec-PrPres in the presence of 30 glass beads takes approximately 2.5 h. This suggests that the event of spontaneous rec-PrP misfolding leading to the formation of propagation nuclei is relatively infrequent and slow, followed by a very rapid propagation phase.
Discussion
Despite the fact that the causal agent of TSEs and its pathogenic mechanism was described four decades ago [57], the main event of PrPC to PrPSc conversion or misfolding, which remains mostly unknown at the molecular level, continues to pose significant challenges. Even after the atomic-level resolution of the three dimensional structures of few prion strains [15, 48, 51], the detailed mechanism by which the globular, natively folded cellular protein transitions into the β-sheet rich structure that ends up forming large amyloid fibrils is yet to be fully described. However, spontaneous misfolding of wild-type PrPC is an extremely rare event, occurring apparently randomly in approximately one individual per million per year [27]. Consequently, it presents extraordinary challenges for in vivo and in vitro modeling. Therefore, there is a pressing need for model systems allowing the systematic study of this pivotal event, which underlies most forms of TSEs. These systems can help address several questions: is spontaneous misfolding a completely stochastic event, or could it be favored/induced/triggered by yet unknown factors? Are cofactors necessary for the event to occur, and if so, how do they interact with PrP? How can different strains arise from the spontaneous misfolding of the same PrP? Are there preferred conformers for a determined PrP sequence? Can the spontaneous formation of such conformations be controlled to obtain a specific strain?
Modelling sporadic, or more precisely, spontaneous idiopathic prion diseases in animal models has been attempted through introduction of PRNP mutations associated with human genetic prion diseases, potentially able to increase the proneness of spontaneous misfolding. However, the diseases developed in such transgenic animals have proven to be poorly transmissible, if at all, in wild-type animals [9, 35, 43, 76]. Consequently, they do not faithfully replicate the characteristics of a truly sporadic prion disease. Fortunately, the discovery of bank voles (Myodes glareolus) and their high susceptibility to prion diseases led to the first model of sporadic disorders. Although it relies on overexpression, this model consistently exhibits the spontaneous development of a transmissible prion disease. The susceptibility is determined by a specific polymorphic variant that seems to favor the disease when overexpressed [73]. Interestingly, this variant is also naturally occurring in some sheep breeds and has been used to develop a new model for sporadic disease [70]. This is one of the reasons why recombinant bank vole PrP with this variant was chosen for the development of an in vitro system to facilitate the systematic study of spontaneous protein misfolding. Furthermore, we aimed to establish a simple model for investigating such a complex phenomenon, being in vitro prion misfolding or propagation systems the most suitable for this purpose. In this regard, we built upon previous work that initiated with the development of PMCA based on brain homogenates as a source of PrPC [12, 60], which has since evolved over the past decade to incorporate bacterially expressed recombinant PrP and chemically defined cofactors [25, 33, 71]. Therefore, we decided to pursue a similar approach but with an even simpler methodology that would be as robust as PMCA in terms of recombinant prion propagation, namely PMSA [30].
In the light of the infrequent generation of rec-PrPres in unseeded controls or tubes with highly diluted seeds in PMSA, and taking advantage of the simplicity of the system in terms of component number, we envisaged a unique opportunity to develop a robust method for consistent spontaneous prion misfolding and to explore the contributing factors. PMSA for prion propagation is roughly composed by six elements: the recombinant protein, conversion buffer (with salts and detergent), a polyanionic cofactor (dextran sulfate), zirconia silicate beads, shaking, and temperature. Together, these components support efficient prion propagation and occasionally lead to spontaneous rec-PrP misfolding. Hence, our aim was to analyze the contribution of each component to this phenomenon in order to enhance spontaneous misfolding. Initially, we considered increasing the concentration of rec-PrP in the substrate, as observed in overexpressing animals such as transgenic mice overexpressing bank vole PrP, which spontaneously developed a prion disease [73]. However, previous studies investigating the effect of rec-PrP concentration in the PMSA substrate for prion propagation revealed no significant change in the efficiency of the process for concentrations above 1 µM [30]. Thus, and taking into account that with few exceptions such as bank vole PrP, animals overexpressing other wild-type prion proteins do not develop spontaneous bona fide prion disease [74], the role of rec-PrP concentration as a critical parameter for enhancing spontaneous misfolding was discarded. The presence of polyanionic and lipidic cofactors in prion propagation substrates has been demonstrated to improve prion propagation efficiency [4, 24] and is considered crucial to obtain infectious recombinant prions [10]. These cofactors have also been proposed to influence strain properties [11, 26, 33], yet their potential contribution to spontaneous misfolding remains uncertain. It is noteworthy that bona fide recombinant prions have been generated spontaneously both in the presence [33, 66, 71] and absence [18, 44] of non-protein cofactors, suggesting that their presence is not strictly necessary for the event to occur in vitro. Nonetheless, including these cofactors in substrates aimed to in vitro prion propagation has been shown to enhance propagation efficiency, although this effect could be strain dependent, with each specific cofactor favoring distinct conformers [11]. The likelihood of any polyanionic or lipidic cofactor, among those known to be useful in prion propagation, specifically stimulate spontaneous misfolding is highly unlikely. In a previous work, we used recombinant bank vole protein as a substrate in PMCA, along with various polyanionic cofactors and performed serial unseeded PMCA rounds to generate spontaneously misfolded rec-PrPres with distinct efficiencies. In the absence of cofactors, a minimum of 40 rounds was required for spontaneous rec-PrPres formation. However, the addition of dextran sulfate, RNA or DNA to the substrate significantly accelerated the event reducing the number of required PMCA rounds by at least 12 [33]. This observation indicates that cofactors could overall enhance both spontaneous and induced PrP misfolding. Furthermore, it is worth noting that the electrophoretic patterns of spontaneously generated rec-PrPres were specific for each tested cofactor. These patterns coincided with those resulting from prion propagation when using the same substrates, suggesting that distinct cofactors may specifically promote misfolding into different conformers [33]. This, in turn, could influence the specific promoter effect of each cofactor on the spontaneous misfolding of PrP with different sequences. An illustrative example is the case of dextran, which acts as an enhancer for bovine spongiform encephalopathy prion propagation [53] but as an inhibitor for scrapie prions [29]. In any case, and despite the possibility of introducing a bias in our system due to the potential strain selectivity of a determined cofactor, sulfated dextran was chosen as an overall enhancer for misfolding in the presented PMSA methodology. This choice was made with the objective of developing a system for rapid and consistent spontaneous prion formation in vitro, and sulfated dextran was found to be the most consistent cofactor among those previously utilized [33]. The physical reaction parameters, such as temperature and shaking speed, were also evaluated during the optimization of PMSA for prion propagation. Given that a range of temperatures did not show any significant effect on efficiency, it was discarded as a potential major contributor to spontaneous misfolding. In contrast, variations in shaking speed had a profound effect on the efficiency of recombinant prion propagation. Shaking speeds below 700 rpm and above 1000 rpm demonstrated a reduction in propagation efficiency of a serially diluted seed [30]. Since highly efficient in vitro prion propagation methods typically involve sonication or shaking, one might speculate that external energy input is necessary for in vitro PrP misfolding. However, our previous observation of reduced efficiency at high shaking speeds led us to the conclusion that increased energy input is not directly correlated with an enhanced misfolding efficiency. Lastly, it was essential to investigate the role of the beads considering their known contribution to enhanced prion propagation in vitro [32, 39] and the previous observations on recombinant prion propagation in PMSA [30]. Indeed, as shown in Results section, changing the material of beads was the pivotal factor for the transition from a method that exhibited high efficiency in prion propagation but rarely induced spontaneous misfolded rec-PrPres to a method that systematically and remarkably induced spontaneous misfolding with unprecedented efficiency.
Therefore, one of the main inquiries arising from our results is the underlying distinction between glass beads and the other tested materials. Here, we have demonstrated that both native rec-PrP and rec-PrPSc are adsorbed onto the glass surface of the beads. This leads us to theorize about the potential role of rec-PrP concentration on the glass surface, wherein an increased local concentration of the substrate may enhance the frequency of spontaneous misfolding. Additionally, glass beads could facilitate the association of the few rec-PrPSc seeds formed spontaneously with rec-PrP or even with the polyanionic cofactor, thereby promoting misfolding. This role can be likened to the proposed function of lipid rafts in vivo [54]. Nonetheless, the involvement of lipid rafts in the pathobiology of prion diseases appears to be more complex, with a closer relationship to their lipidic content rather than solely providing a gathering point for PrPC and PrPSc [1]. Furthermore, other materials that have been shown to adsorb PrP or prions [31] may do so even more efficiently than glass beads without promoting spontaneous misfolding. An example of this is seen with zirconium silicate beads, which can effectively store recombinant prion seeds adsorbed on their surface but lack the dramatic effect of inducing spontaneous misfolding observed with glass beads. The binding of proteins to different materials, such as plastic tubes compared to glass, has been assessed as early as 1978. These studies demonstrated that proteins exhibit a greater affinity for most of the plastic surfaces than for glass. However, the presence of detergents, such as Triton-X-100 in our conversion buffer, significantly reduces the adherence of proteins to plastics compared to glass [19], which may be relevant to our system. In the specific case of prions, it has been shown that stainless steel wires can efficiently bind PrPSc [80]. Moreover, when incubated with healthy brain homogenates, stainless steel wires can also to give rise to apparently spontaneously misfolded PrPSc, albeit with a low frequency [28]. This further highlights the potential influence of different materials on prion behavior and misfolding dynamics. However, the use of stainless steel beads in PMSA did not promote spontaneous misfolding to the same extent as observed with glass beads, if at all. The potential adsorption of natively folded PrP to steel surfaces remains to be assessed, and therefore, it is unknown whether steel-induced spontaneous misfolding operates through the same mechanisms as glass-induced misfolding. It is possible that some physicochemical properties unique to glass surfaces are responsible for the highly efficient induction of spontaneous recombinant prion misfolding. Further investigation is needed to elucidate the exact mechanisms underlying the differential effects of glass and steel beads on spontaneous misfolding. The negative surface charge density acquired by glass in aqueous solutions, resulting from the deprotonation of terminal silanol groups [6, 7, 16], suggests the formation of electrostatic interactions between rec-PrP and the glass surface. These interactions not only driving the adsorption process but also having the potential to affect the native structure of PrP. As salt bridges may play an important role in stabilizing the structure of PrPC, the disruption of at least a proportion of these salt bridges is likely required for misfolding to occur [40]. Thus, it is plausible that the contribution of the glass surface to the event consists of a partial destabilization of the native PrP conformation, thereby promoting spontaneous misfolding. However, this hypothesis alone does not fully explain the observed results. It should be noted that, in addition to the glass surface, bead movement was also found to be necessary for highly efficient spontaneous rec-PrP misfolding. Assuming the existence of a significant energy barrier that prevents the misfolding of PrPC to PrPSc [79], the destabilization of the native structure of PrPC through its interaction with the glass surface may serve to lower this barrier by increasing the free energy of PrPC to some extent. Consequently, the glass-bound PrP would become an energetically unstable intermediate along the misfolding pathway, resembling the proposed concept of PrP* [20]. However, an additional energy input would still be required to overcome the energetic barrier from PrPC (or PrP*) to PrPSc, and this energy could potentially be provided by the movement of the beads. A speculative possibility would be that the kinetic energy generated by the movement of the beads could be transferred to the tightly bound rec-PrP on their surface. As the mass of the bead combines with the mass of the rec-PrP molecule adsorbed to its surface, the additional kinetic energy could facilitate overcoming the energetic barrier. Further studies aimed at elucidating the molecular mechanisms driving this phenomenon in vitro are of great interest, since they could potentially provide insights into equivalent phenomena occurring in vivo. Such understanding would be crucial in unraveling the triggers of rare sporadic prion disorders.
Another interesting observation worth discussing and potentially related to the essential components for spontaneous PrP misfolding is the possible requirement of rec-PrP presence in solution. While analyzing the impact of glass surface area on spontaneous rec-PrPSc formation, the need of a minimum surface area was clearly established. However, due to technical limitations, whether a maximum surface area exists could not be precisely determined. However, in experiments performed with an excess of glass beads (with estimated surface areas of 2500π mm2), no spontaneous rec-PrPres formation was observed. This suggests the existence of an upper limit to glass surface. In the light of this observation and the remarkable capacity of glass surfaces to adsorb rec-PrP, we hypothesize that with extremely high glass surfaces available during the reaction, there could be a rapid and complete depletion of rec-PrP in solution, with all the rec-PrP adsorbed onto the surface. The requirement for soluble or non-bead surface-bound rec-PrP for highly efficient spontaneous conversion is reminiscent of the higher efficiency of GPI-less PrP in propagating prions in vivo compared to membrane-bound PrP. This GPI-less PrP has shown higher levels of PrPres despite a reduced neurotoxicity [17]. Furthermore, studies on transgenic mice expressing anchorless PrP have demonstrated the development of spontaneous disease in approximately 50% of the cases, with long incubation periods. However, when GPI-anchored PrP was co-expressed at low levels (0.5 x) with the GPI-less protein, spontaneous disease onset occurred in 100% of the animals with much shorter incubation periods [64]. These findings further suggest that the presence of both membrane-bound and anchorless PrP somehow benefits spontaneous misfolding in vivo, similar to the potential interplay between glass bead-bound and soluble rec-PrP in PMSA. Taking this into account, and the evidences indicating that spontaneous misfolding is an infrequent event that might be associated to the glass surface, we propose a model of this highly spontaneous conversion system, shown in a short animation included as Additional file 2.
Apart from the system developed, which holds invaluable potential for gaining insights into the mechanisms triggering spontaneous PrP misfolding and the influence of cofactors, PrP sequence variations, or other physicochemical factors in this process, the spontaneously generated products in this system are of significant importance. Although some of our previous work suggests that distinct cofactors could restrict or modulate the formation or selective propagation of specific strains [33], even in the presence of different seeds [26], we now report the generation of at least four different strains through the same procedure and with the use of the same polyanionic cofactor. This occurrence is not unprecedented, as the arousal of different prion conformers from the same procedure, employing the same cofactor, has been demonstrated previously [67, 77]. This phenomenon could also be happening in vivo, as coexistence of different strains within the same patient have been estimated to occur in 35% of sCJD cases [56]. Although the cofactor selection model [65] suggests that this may be due to the presence of distinct cofactors in different brain areas, which determine the occurrence of specific strains, the discovery of mixed strains within a single brain area [45], implies the involvement of other mechanisms in the formation of multiple strains. In this study, we show that even in a simple experimental system, multiple strains can emerge from the same procedure, although differences in their formation frequencies suggest the existence of a preferred conformer for the specific combination of rec-PrP and cofactor. Such method, able to reproduce in vitro the spontaneous formation of prions with accelerated kinetics and giving rise to multiple strains, offers several possibilities to address questions underlying idiopathic prion disorders. Among others, we are currently expanding the potential of the system to analyze the spontaneous misfolding proneness of hundreds of distinct PrP variants in order to decipher the motifs or residues facilitating this event. Another example of the potential of the method is the investigation of PrP-cofactor interactions driving this process. Distinct, ad hoc designed polyanionic cofactors promoting spontaneous PrP misfoding can be easily screened through PMSA, what could help unveil the necessary cofactor-PrP interactions. Given the potential role of polyanionic cofactors in prion disease, in which for example, shortening of heparan sulfate chains from brain prolongs survival in prion infected animals [2], these kind of compounds from brain could have also an effect on the pathobiology of sporadic prion disorders. The method presented here could help unveil any potential PrP-cofactor interactions potentially leading to the development of a sporadic prion disease.
Altogether, we present here the first method that consistently induces spontaneous misfolding of bona fide recombinant prions. This misfolding is primarily facilitated by the addition of glass beads to the PMSA reaction, which, likely through electrostatic interactions with the rec-PrP, significantly enhance their proneness to spontaneous conversion into highly infectious and transmissible prions. Furthermore, our method generates multiple prion strains under identical conditions, including the use of the same cofactor molecule. These findings challenge existing theories regarding the role of cofactors in prion strain selection or emergence, highlighting the potential of our method to explore complex aspects such as the triggers for spontaneous prion misfolding and the involvement of cofactors and other elements in this process.
References
Agostini F, Dotti CG, Perez-Canamas A, Ledesma MD, Benetti F, Legname G (2013) Prion protein accumulation in lipid rafts of mouse aging brain. PLoS ONE 8:e74244. https://doi.org/10.1371/journal.pone.0074244
Aguilar-Calvo P, Sevillano AM, Bapat J, Soldau K, Sandoval DR, Altmeppen HC, Linsenmeier L, Pizzo DP, Geschwind MD, Sanchez H et al (2019) Shortening heparan sulfate chains prolongs survival and reduces parenchymal plaques in prion disease caused by mobile, ADAM10-cleaved prions. Acta Neuropathol 139:527–546. https://doi.org/10.1007/s00401-019-02085-x
Aguzzi A, Calella AM (2009) Prions: protein aggregation and infectious diseases. Physiol Rev 89:1105–1152. https://doi.org/10.1152/physrev.00006.2009
Baron GS, Caughey B (2003) Effect of glycosylphosphatidylinositol anchor-dependent and -independent prion protein association with model raft membranes on conversion to the protease-resistant isoform. J Biol Chem 278:14883–14892. https://doi.org/10.1074/jbc.M210840200
Barria MA, Mukherjee A, Gonzalez-Romero D, Morales R, Soto C (2009) De novo generation of infectious prions in vitro produces a new disease phenotype. PLoS Pathog 5:e1000421. https://doi.org/10.1371/journal.ppat.1000421
Bather JM, Gray RAC (1976) Relationship between chromatographic performance and surface structure of silica microspheres. J Chromatogr A 122:159–169. https://doi.org/10.1016/S0021-9673(00)82242-6
Behrens SH, Girer DG (2001) The charge of glass and silica surfaces. J Chem Phys 115:6716–6721. https://doi.org/10.1063/1.1404988
Bessen RA, Kocisko DA, Raymond GJ, Nandan S, Lansbury PT, Caughey B (1995) Non-genetic propagation of strain-specific properties of scrapie prion protein. Nature 375:698–700. https://doi.org/10.1038/375698a0
Bouybayoune I, Mantovani S, Del Gallo F, Bertani I, Restelli E, Comerio L, Tapella L, Baracchi F, Fernandez-Borges N, Mangieri M et al (2015) Transgenic fatal familial insomnia mice indicate prion infectivity-independent mechanisms of pathogenesis and phenotypic expression of disease. PLoS Pathog 11:e1004796. https://doi.org/10.1371/journal.ppat.1004796
Burke C, Walsh D, Steele A, Agrimi U, Di Bari MA, Watts JC, Supattapone S (2019) Full restoration of specific infectivity and strain properties from pure mammalian prion protein. PLoS Pathog 15:e1007662. https://doi.org/10.1371/journal.ppat.1007662
Burke CM, Walsh DJ, Mark KMK, Deleault NR, Nishina KA, Agrimi U, Di Bari MA, Supattapone S (2020) Cofactor and glycosylation preferences for in vitro prion conversion are predominantly determined by strain conformation. PLoS Pathog 16:e1008495. https://doi.org/10.1371/journal.ppat.1008495
Castilla J, Morales R, Saa P, Barria M, Gambetti P, Soto C (2008) Cell-free propagation of prion strains. EMBO J 27:2557–2566. https://doi.org/10.1038/emboj.2008.181
Castilla J, Saa P, Hetz C, Soto C (2005) In vitro generation of infectious scrapie prions. Cell 121:195–206. https://doi.org/10.1016/j.cell.2005.02.011
Caughey B, Kocisko DA, Raymond GJ, Lansbury PT Jr (1995) Aggregates of scrapie-associated prion protein induce the cell-free conversion of protease-sensitive prion protein to the protease-resistant state. Chem Biol 2:807–817
Caughey B, Standke HG, Artikis E, Hoyt F, Kraus A (2022) Pathogenic prion structures at high resolution. PLoS Pathog 18:e1010594. https://doi.org/10.1371/journal.ppat.1010594
Chartier P (1997) La superficie del vidrio: bases para la investigación industrial. Boletín de la Sociedad Española de Cerámica y Vidrio 36:10261/50675
Chesebro B, Trifilo M, Race R, Meade-White K, Teng C, LaCasse R, Raymond L, Favara C, Baron G, Priola S et al (2005) Anchorless prion protein results in infectious amyloid disease without clinical scrapie. Science 308:1435–1439. https://doi.org/10.1126/science.1110837
Choi JK, Cali I, Surewicz K, Kong Q, Gambetti P, Surewicz WK (2016) Amyloid fibrils from the N-terminal prion protein fragment are infectious. Proc Natl Acad Sci USA 113:13851–13856. https://doi.org/10.1073/pnas.1610716113
Christensen P, Johansson A, Nielsen V (1978) Quantitation of protein adsorbance to glass and palstics: investigation of a new tube with low adherence. J Immunol Methods 23:23–28. https://doi.org/10.1016/0022-1759(78)90106-0
Cohen FE, Prusiner SB (1998) Pathologic conformations of prion proteins. Annu Rev Biochem 67:793–819. https://doi.org/10.1146/annurev.biochem.67.1.793
Colby DW, Giles K, Legname G, Wille H, Baskakov IV, DeArmond SJ, Prusiner SB (2009) Design and construction of diverse mammalian prion strains. Proc Natl Acad Sci USA 106:20417–20422. https://doi.org/10.1073/pnas.0910350106
Colby DW, Wain R, Baskakov IV, Legname G, Palmer CG, Nguyen HO, Lemus A, Cohen FE, DeArmond SJ, Prusiner SB (2010) Protease-sensitive synthetic prions. PLoS Pathog 6:e1000736. https://doi.org/10.1371/journal.ppat.1000736
Deleault NR, Harris BT, Rees JR, Supattapone S (2007) Formation of native prions from minimal components in vitro. Proc Natl Acad Sci USA 104:9741–9746. https://doi.org/10.1073/pnas.0702662104
Deleault NR, Lucassen RW, Supattapone S (2003) RNA molecules stimulate prion protein conversion. Nature 425:717–720. https://doi.org/10.1038/nature01979
Deleault NR, Piro JR, Walsh DJ, Wang F, Ma J, Geoghegan JC, Supattapone S (2012) Isolation of phosphatidylethanolamine as a solitary cofactor for prion formation in the absence of nucleic acids. Proc Natl Acad Sci USA 109:8546–8551. https://doi.org/10.1073/pnas.1204498109
Deleault NR, Walsh DJ, Piro JR, Wang F, Wang X, Ma J, Rees JR, Supattapone S (2012) Cofactor molecules maintain infectious conformation and restrict strain properties in purified prions. Proc Natl Acad Sci USA 109:E1938-1946. https://doi.org/10.1073/pnas.1206999109
Department of Health and Human Services CfDCaP. Creutzfeldt–Jakob disease, classic (CJD), occurrence and transmission https://www.cdc.gov/prions/cjd/occurrence-transmission.html (2022). Accessed 5 Jan 2023.
Edgeworth JA, Gros N, Alden J, Joiner S, Wadsworth JD, Linehan J, Brandner S, Jackson GS, Weissmann C, Collinge J (2010) Spontaneous generation of mammalian prions. Proc Natl Acad Sci USA 107:14402–14406. https://doi.org/10.1073/pnas.1004036107
Ehlers B, Diringer H (1984) Dextran sulphate 500 delays and prevents mouse scrapie by impairment of agent replication in spleen. J Gen Virol 65(Pt 8):1325–1330
Erana H, Charco JM, Di Bari MA, Diaz-Dominguez CM, Lopez-Moreno R, Vidal E, Gonzalez-Miranda E, Perez-Castro MA, Garcia-Martinez S, Bravo S et al (2019) Development of a new largely scalable in vitro prion propagation method for the production of infectious recombinant prions for high resolution structural studies. PLoS Pathog 15:e1008117. https://doi.org/10.1371/journal.ppat.1008117
Erana H, Perez-Castro MA, Garcia-Martinez S, Charco JM, Lopez-Moreno R, Diaz-Dominguez CM, Barrio T, Gonzalez-Miranda E, Castilla J (2020) A novel, reliable and highly versatile method to evaluate different prion decontamination procedures. Front Bioeng Biotechnol 8:589182. https://doi.org/10.3389/fbioe.2020.589182
Fernandez-Borges N, Castilla J (2010) PMCA. A decade of in vitro prion replication. Curr Chem Biol 4:200–207. https://doi.org/10.2174/187231310792062693
Fernández-Borges N, Di Bari MA, Erana H, Sanchez-Martin M, Pirisinu L, Parra B, Elezgarai SR, Vanni I, Lopez-Moreno R, Vaccari G et al (2017) Cofactors influence the biological properties of infectious recombinant prions. Acta Neuropathol. https://doi.org/10.1007/s00401-017-1782-y
Fernandez-Borges N, Erana H, Elezgarai SR, Harrathi C, Venegas V, Castilla J (2017) A quick method to evaluate the effect of the amino acid sequence in the misfolding proneness of the prion protein. Methods Mol Biol 1658:205–216. https://doi.org/10.1007/978-1-4939-7244-9_15
Friedman-Levi Y, Meiner Z, Canello T, Frid K, Kovacs GG, Budka H, Avrahami D, Gabizon R (2011) Fatal prion disease in a mouse model of genetic E200K Creutzfeldt–Jakob disease. PLoS Pathog 7:e1002350. https://doi.org/10.1371/journal.ppat.1002350
Geoghegan JC, Valdes PA, Orem NR, Deleault NR, Williamson RA, Harris BT, Supattapone S (2007) Selective incorporation of polyanionic molecules into hamster prions. J Biol Chem 282:36341–36353. https://doi.org/10.1074/jbc.M704447200
Goldman JS, Vallabh SM (2022) Genetic counseling for prion disease: updates and best practices. Genet Med 24:1993–2003. https://doi.org/10.1016/j.gim.2022.06.003
Gonzalez-Montalban N, Makarava N, Ostapchenko VG, Savtchenk R, Alexeeva I, Rohwer RG, Baskakov IV (2011) Highly efficient protein misfolding cyclic amplification. PLoS Pathog 7:e1001277. https://doi.org/10.1371/journal.ppat.1001277
Gonzalez-Montalban N, Makarava N, Savtchenko R, Baskakov IV (2011) Relationship between conformational stability and amplification efficiency of prions. Biochemistry 50:7933–7940. https://doi.org/10.1021/bi200950v
Guest WC, Cashman NR, Plotkin SS (2010) Electrostatics in the stability and misfolding of the prion protein: salt bridges, self energy, and solvation. Biochem Cell Biol 88:371–381. https://doi.org/10.1139/o09-180
Harrathi C, Fernandez-Borges N, Erana H, Elezgarai SR, Venegas V, Charco JM, Castilla J (2018) Insights into the bidirectional properties of the sheep-deer prion transmission barrier. Mol Neurobiol. https://doi.org/10.1007/s12035-018-1443-8
Imran M, Mahmood S (2011) An overview of animal prion diseases. Virol J 8:493. https://doi.org/10.1186/1743-422X-8-493
Jackson WS, Borkowski AW, Faas H, Steele AD, King OD, Watson N, Jasanoff A, Lindquist S (2009) Spontaneous generation of prion infectivity in fatal familial insomnia knockin mice. Neuron 63:438–450. https://doi.org/10.1016/j.neuron.2009.07.026
Kim JI, Cali I, Surewicz K, Kong Q, Raymond GJ, Atarashi R, Race B, Qing L, Gambetti P, Caughey B et al (2010) Mammalian prions generated from bacterially expressed prion protein in the absence of any mammalian cofactors. J Biol Chem 285:14083–14087. https://doi.org/10.1074/jbc.C110.113464
Kobayashi A, Iwasaki Y, Takao M, Saito Y, Iwaki T, Qi Z, Torimoto R, Shimazaki T, Munesue Y, Isoda N et al (2019) A Novel combination of prion strain co-occurrence in patients with sporadic Creutzfeldt–Jakob disease. Am J Pathol 189:1276–1283. https://doi.org/10.1016/j.ajpath.2019.02.012
Kocisko DA, Come JH, Priola SA, Chesebro B, Raymond GJ, Lansbury PT, Caughey B (1994) Cell-free formation of protease-resistant prion protein. Nature 370:471–474. https://doi.org/10.1038/370471a0
Kocisko DA, Priola SA, Raymond GJ, Chesebro B, Lansbury PT Jr, Caughey B (1995) Species specificity in the cell-free conversion of prion protein to protease-resistant forms: a model for the scrapie species barrier. Proc Natl Acad Sci USA 92:3923–3927
Kraus A, Hoyt F, Schwartz CL, Hansen B, Artikis E, Hughson AG, Raymond GJ, Race B, Baron GS, Caughey B (2021) High-resolution structure and strain comparison of infectious mammalian prions. Mol Cell. https://doi.org/10.1016/j.molcel.2021.08.011PMID-34433091
Legname G, Baskakov IV, Nguyen HO, Riesner D, Cohen FE, DeArmond SJ, Prusiner SB (2004) Synthetic mammalian prions. Science 305:673–676. https://doi.org/10.1126/science.1100195
Makarava N, Kovacs GG, Bocharova O, Savtchenko R, Alexeeva I, Budka H, Rohwer RG, Baskakov IV (2010) Recombinant prion protein induces a new transmissible prion disease in wild-type animals. Acta Neuropathol 119:177–187. https://doi.org/10.1007/s00401-009-0633-x
Manka SW, Zhang W, Wenborn A, Betts JP, Joiner S, Saibil H, Collinge J, Wadsworth JD (2022) 2.7 Å cryo-EM structure of ex vivo RML prion fibrils. Nat Commun. https://doi.org/10.1038/s41467-022-30457-7
Meyerett-Reid C, Wyckoff AC, Spraker T, Pulford B, Bender H, Zabel MD (2017) De novo generation of a unique cervid prion strain using protein misfolding cyclic amplification. mSphere 2:e00372-e1316. https://doi.org/10.1128/mSphere.00372-16
Murayama Y, Yoshioka M, Masujin K, Okada H, Iwamaru Y, Imamura M, Matsuura Y, Fukuda S, Onoe S, Yokoyama T et al (2010) Sulfated dextrans enhance in vitro amplification of bovine spongiform encephalopathy PrP(Sc) and enable ultrasensitive detection of bovine PrP(Sc). PLoS ONE. https://doi.org/10.1371/journal.pone.0013152
Naslavsky N, Stein R, Yanai A, Friedlander G, Taraboulos A (1997) Characterization of detergent-insoluble complexes containing the cellular prion protein and its scrapie isoform. J Biol Chem 272:6324–6331
Noble GP, Wang DW, Walsh DJ, Barone JR, Miller MB, Nishina KA, Li S, Supattapone S (2015) A structural and functional comparison between infectious and non-infectious autocatalytic recombinant PrP conformers. PLoS Pathog 11:e1005017. https://doi.org/10.1371/journal.ppat.1005017
Parchi P, Strammiello R, Notari S, Giese A, Langeveld JP, Ladogana A, Zerr I, Roncaroli F, Cras P, Ghetti B et al (2009) Incidence and spectrum of sporadic Creutzfeldt–Jakob disease variants with mixed phenotype and co-occurrence of PrPSc types: an updated classification. Acta Neuropathol 118:659–671. https://doi.org/10.1007/s00401-009-0585-1
Prusiner SB (1982) Novel proteinaceous infectious particles cause scrapie. Science 216:136–144
Prusiner SB (1998) The prion diseases. Brain Pathol 8:499–513
Ramakrishnan MA (2016) Determination of 50% endpoint titer using a simple formula. World J Virol 5:85–86. https://doi.org/10.5501/wjv.v5.i2.85
Saa P, Castilla J, Soto C (2006) Ultra-efficient replication of infectious prions by automated protein misfolding cyclic amplification. J Biol Chem 281:35245–35252. https://doi.org/10.1074/jbc.M603964200
Saborio GP, Permanne B, Soto C (2001) Sensitive detection of pathological prion protein by cyclic amplification of protein misfolding. Nature 411:810–813. https://doi.org/10.1038/35081095
Siso S, Ordonez M, Cordon I, Vidal E, Pumarola M (2004) Distribution of PrP(res) in the brains of BSE-affected cows detected by active surveillance in Catalonia, Spain. Vet Rec 155:524–525
Soto C (2011) Prion hypothesis: the end of the controversy? Trends Biochem Sci 36:151–158. https://doi.org/10.1016/j.tibs.2010.11.001
Stohr J, Watts JC, Legname G, Oehler A, Lemus A, Nguyen HO, Sussman J, Wille H, DeArmond SJ, Prusiner SB et al (2011) Spontaneous generation of anchorless prions in transgenic mice. Proc Natl Acad Sci USA 108:21223–21228. https://doi.org/10.1073/pnas.1117827108
Supattapone S (2020) Cofactor molecules: essential partners for infectious prions. Prog Mol Biol Transl Sci 175:53–75. https://doi.org/10.1016/bs.pmbts.2020.07.009
Supattapone S (2014) Synthesis of high titer infectious prions with cofactor molecules. J Biol Chem 289:19850–19854. https://doi.org/10.1074/jbc.R113.511329
Timmes AG, Moore RA, Fischer ER, Priola SA (2013) Recombinant prion protein refolded with lipid and RNA has the biochemical hallmarks of a prion but lacks in vivo infectivity. PLoS ONE 8:e71081. https://doi.org/10.1371/journal.pone.0071081
Uflacker A, Doraiswamy PM, Rechitsky S, See T, Geschwind M, Tur-Kaspa I (2014) Preimplantation genetic diagnosis (PGD) for genetic prion disorder due to F198S mutation in the PRNP gene. JAMA Neurol 71:484–486. https://doi.org/10.1001/jamaneurol.2013.5884
Vidal E, Fernández-Borges N, Pintado B, Eraña H, Ordoñez M, Márquez M, Chianini F, Fondevila D, Sánchez-Martín MA, Andreoletti O et al (2015) Transgenic mouse bioassay: evidence that rabbits are susceptible to a variety of prion isolates. PLoS Pathog 11:e1004977. https://doi.org/10.1371/journal.ppat.1004977
Vidal E, Sánchez-Martín MA, Eraña H, Pérez-Lázaro S, Pérez-Castro MA, Otero A, Charco JM, Marín B, López-Moreno R, Díaz-Domínguez CM, et al. Bona fide spontaneous and atypical scrapie faithfully reproduced through the expression of a polymorphic variant of ovine prion protein. In: Prion 2022 conference. Prion (Taylor & Francis), City, pp 95–253 (2022).
Wang F, Wang X, Yuan CG, Ma J (2010) Generating a prion with bacterially expressed recombinant prion protein. Science 327:1132–1135. https://doi.org/10.1126/science.1183748
Watson N, Brandel J-P, Green A, Hermann P, Ladogana A, Lindsay T, Mackenzie J, Pocchiari M, Smith C, Zerr I et al (2021) The importance of ongoing international surveillance for Creutzfeldt–Jakob disease. Nat Rev Neurol 17:362–379. https://doi.org/10.1038/s41582-021-00488-7PMID-33972773
Watts JC, Giles K, Stohr J, Oehler A, Bhardwaj S, Grillo SK, Patel S, DeArmond SJ, Prusiner SB (2012) Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein. Proc Natl Acad Sci USA 109:3498–3503. https://doi.org/10.1073/pnas.1121556109
Westaway D, DeArmond SJ, Cayetano-Canlas J, Groth D, Foster D, Yang SL, Torchia M, Carlson GA, Prusiner SB (1994) Degeneration of skeletal muscle, peripheral nerves, and the central nervous system in transgenic mice overexpressing wild-type prion proteins. Cell 76:117–129. https://doi.org/10.1016/0092-8674(94)90177-5
Wong C, Xiong LW, Horiuchi M, Raymond L, Wehrly K, Chesebro B, Caughey B (2001) Sulfated glycans and elevated temperature stimulate PrP(Sc)-dependent cell-free formation of protease-resistant prion protein. EMBO J 20:377–386. https://doi.org/10.1093/emboj/20.3.377
Yang W, Cook J, Rassbach B, Lemus A, DeArmond SJ, Mastrianni JA (2009) A new transgenic mouse model of Gerstmann–Straussler–Scheinker syndrome caused by the A117V mutation of PRNP. J Neurosci 29:10072–10080. https://doi.org/10.1523/JNEUROSCI.2542-09.2009
Zhang Y, Wang F, Wang X, Zhang Z, Xu Y, Yu G, Yuan C, Ma J (2014) Comparison of 2 synthetically generated recombinant prions. Prion 8:215–220. https://doi.org/10.4161/pri.28669
Zhang Z, Zhang Y, Wang F, Wang X, Xu Y, Yang H, Yu G, Yuan C, Ma J (2013) De novo generation of infectious prions with bacterially expressed recombinant prion protein. FASEB J 27:4768–4775. https://doi.org/10.1096/fj.13-233965
Zhou Z, Xiao G (2013) Conformational conversion of prion protein in prion diseases. Acta Biochim Biophys Sin (Shanghai) 45:465–476. https://doi.org/10.1093/abbs/gmt027
Zobeley E, Flechsig E, Cozzio A, Enari M, Weissmann C (1999) Infectivity of scrapie prions bound to a stainless steel surface. Mol Med 5:240–243
Acknowledgements
The authors would like to thank the following for their support: IKERBasque foundation, vivarium, maintenance and Electron Microscopy Platform from CIC bioGUNE for outstanding assistance; Maria de la Sierra Espinar for technical support, IRTA-CReSA’s biocontainment unit staff for excellent care and maintenance of the animals. The authors are also thankful for technical and human support provided by SGIker (UPV/EHU/ ERDF, EU), specifically the Scanning Electron Microscopy service.
Funding
The present work was partially funded by three different grants awarded by “Ministerio de Economía y Competitividad” (Spanish Government), grant numbers PID2021-122201OB-C21, PID2021-1222010B-C22 and PID2020-117465GB-I00, funded by MCIN/AEI/10.13039/501100011033 and co-financed by the European Regional Development Fund (ERDF), and by the Instituto de Salud Carlos III (ISCIII), grant number AC21_2/00024. Additionally, CIC bioGUNE currently holds a Severo Ochoa Excellence accreditation, CEX2021-001136-S, also funded by MCIN/AEI/10.13039/501100011033. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Author information
Authors and Affiliations
Contributions
JC, HE, EV and JRR participated on the conception of the work and funding acquisition. JC, HE, CDD, JMC, EV, EGM, MAPC, PP, CSTQ, LFV, JTG, NLL, ASS, ML, SGM, NGA, MSJA, JGA, EFM, SG, MV, GCT and MG performed the experiments and contributed to data analysis and interpretation of results. JC, HE, CDD and JMC wrote the manuscript with contributions from the rest of the authors. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing interests
Authors have read the journal’s policy and have the following competing interests that need to be declared: Authors Hasier Eraña and Jorge M. Charco are employed by the commercial company ATLAS Molecular Pharma SL. This does not alter our adherence to all Journal policies on sharing data and materials and did not influence in any way the work reported in this manuscript.
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1.
Supplementary figures, tables and methods.
Additional file 2. Descriptive video of the PMSA procedure developed for the generation of spontaneous protein misfolding
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Eraña, H., Díaz-Domínguez, C.M., Charco, J.M. et al. Understanding the key features of the spontaneous formation of bona fide prions through a novel methodology that enables their swift and consistent generation. acta neuropathol commun 11, 145 (2023). https://doi.org/10.1186/s40478-023-01640-8
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s40478-023-01640-8