Skip to main content

Table 4 List of primer and probe sequences (5′–3′) used for real-time quantitative PCR (RT-qPCR)

From: RNA dependent suppression of C9orf72 ALS/FTD associated neurodegeneration by Matrin-3

α-tubulin (Drosophila)  
Primer 1 ACCAGCCTGACCAACATG
Primer 2 CCTCGAAATCGTAGCTCTACAC
Probe /56FAM/TCACACGCG/ZEN/ACAAGGAAAATTCACAGA/3IABkFQ/
MATR3 (human)  
Primer 1 CTTCTTCTGTCTGCGTTCTTCT
Primer 2 TACTGTAAGCTGTGTTCACTCTT
Probe /56FAM/ACTCATTGC/ZEN/AGCAGCCTTCCTCA/3IABkFQ/
GAPDH (human)  
Primer 1 GTGGAGTCATACTGGAACATGTAG
Primer 2 AATGGTGAAGGTCGGTGTG
Probe /56-FAM/TGCAAATGG/ZEN/CAGCCCTGGTG/3IABkFQ/
Dendra2  
Primer 1 ACTTCAAGCAGAGCTTCCC
Primer 2 ACGTTCTGGAAGAAGCAGTC
Probe /56-FAM/CAGATGCCC/ZEN/TTGTCCTCGAAGGTC/3IABkFQ/
GFP  
Primer 1 GAACCGCATCGAGCTGAA
Primer 2 TGCTTGTCGGCCATGATATAG
Probe /56-FAM/ATCGACTTC/ZEN/AAGGAGGACGGCAAC/3IABkFQ/
HIST1H3D  
Primer 1 GGACTTGCGAGCAGTCTG
Primer 2 CATCCAGGCTGTACTGCT
Probe /56-FAM/CCTTGGCCT/ZEN/TGTGGTGACTCTCA/3IABkFQ/
\