Skip to main content

Table 1 qPCR validation for immunoregulatory/neuroprotective genes

From: Polarizing receptor activation dissociates fibroblast growth factor 2 mediated inhibition of myelination from its neuroprotective potential

GeneqPCR validation
fold change (p-value versus control)
fold change
Primer sequence
Cd93240.2 ± 101.2 (***)44.9 ± 9.1 (***)74.123.8CATCTCACTCTTGCTGGCTCT TCTCCTCTTTCTTGGCTTTCC
Il1148.4 ± 19.8 (***)14.9 ± 3.7 (**)47.56.3CTCCCCTCGAGTGTCTTCAG CCATCAGCTGGGAATTTGTC
Hb-egf22.2 ± 12.0 (***)7.1 ± 2.5 (**)11.94.9TTTCTCCTCCAAGCCACAAG TTCCTCTTCTTTTTCCCGTTC
Lif13.6 ± 4.6 (***)3.8 ± 1.7 (*)19.44.0CCTTCCCATCACCCCTGT CGTTGAGTTGAGCCAGTTGA
Mmp1328.6 ± 14.0 (***)2.2 ± 1.8 (ns)28.11.2CTGCGGTTCACTTTGAGGA GAGGCGGGGATAGTCTTTGT
  1. Shown are mean +/− SEM of at least 5 independent experiments; p-values for ΔCt of Control vs FGF2 or F2 V2 respectively (one-way ANOVA, Holm-Sidak post-test); * p < 0.05, ** p < 0.01, *** p < 0.001, ns - not significant