Skip to main content

Table 1 Sequences of Nodal shRNAs

From: Downregulation of Nodal inhibits metastatic progression in retinoblastoma

  CLONE ID Vector Target gene Sequence
A TRCN0000058699 pLKO.1 Nodal (NM_018055.5) CCGGGCGGTTTCAGATGGACCTATTCTCGAGAATAGGTCCATCTGAAACCGCTTTTTG
B TRCN0000058701 pLKO.1 Nodal (NM_018055.5) CCGGTGCCACCAATGTGCTCCTTATCTCGAGATAAGGAGCACATTGGTGGCATTTTTG
C TRCN0000058702 pLKO.1 Nodal (NM_018055.5) CCGGCATAAAGACATGATCGTGGAACTCGAGTTCCACGATCATGTCTTTATGTTTTTG
D TRCN0000429895 pLKO.1 Nodal (NM_018055.5) CCGGGCTCACTTGCCATTGAGATTTCTCGAGAAATCTCAATGGCAAGTGAGCTTTTTTG
E TRCN0000424693 pLKO.1 Nodal (NM_018055.5) CCGGGCATGCTGTATGTGGATAATGCTCGAGCATTATCCACATACAGCATGCTTTTTTG