Skip to main content

Table 1 Primers used for site-directed mutagenesis

From: Critical residues involved in tau binding to fyn: implications for tau phosphorylation in Alzheimer’s disease

Primer name Primer sequence 5′ to 3′
Forward P176A AGCAAAAACCGCTCCCGCTCCAAAG
Reverse P176A CTTTGGAGCGGGAGCGGTTTTTGCT
Forward P182A CGCTCCAAAGACAGCACCCAGCTCTGG
Reverse P182A CCAGAGCTGGGTGCTGTCTTTGGAGCG
Forward P200A TACAGCAGCGCAGGCTCTCCAGGCACTC
Reverse P200A GAGTGCCTGGAGAGCCTGCGCTGCTGTA
Forward P206A GGCTCCCCAGGCACTGCCGGCAGC
Reverse P206A GCTGCCGGCAGTGCCTGGGGAGCC
Forward P213A GCTCCCGCACCGCGTCCCTTCCA
Reverse P213A TGGAAGGGACGCGGTGCGGGAGC
Forward P219A CCCTTCCAACCCCAGCCACCCGGG
Reverse P219A CCCGGGTGGCTGGGGTTGGAAGGG
  1. Primers used for site-directed mutagenesis of tau. The codons mutated to replace proline (P) with alanine (A) in the encoded protein are underlined