Skip to main content

Advertisement

Table 1 Primers used for mutational analysis

From: SF3B1 and EIF1AX mutations occur in primary leptomeningeal melanocytic neoplasms; yet another similarity to uveal melanomas

Gene Exon Forward (Fw) Reverse (Rv) Primer sequence 5′- 3′
SF3B1 14 Fw TGATTATGGAAAGAAATGGTTGAAG
   Rv AGGGCAATAAAGAAGGAATGC
SF3B1 15 Fw TGCAGTTTGGCTGAATAGTTG
   Rv GGCCAAAGCACTGATGGT
EIF1AX 1 Fw CCCCTCGGAGCAGCAG
Rv CCTGGGTGACCTGCAATCTAC
EIF1AX 2 Fw GCCTTAATTTCATTTTATTTCATACTGTTT
   Rv AGGATGTTATTTTAAAAAGCGTAATTT