Skip to main content

Table 2 Primers used for RT-PCR

From: Trichuris suis induces human non-classical patrolling monocytes via the mannose receptor and PKC: implications for multiple sclerosis

Gene Forward (5’–3’) Reverse (5’–3’)
GAPDH CCATGTTCGTCATGGGTGTG GGTGCTAAGCAGTTGGTGGTG
SOCS1 TGAACTCGCACCTCCTACCTCT CAACCCCTGGTTTGTGCAA
IL-10 CGCTGTCATCGATTTCTTCCCT AGGCATTCTTCACCTGCTCCAC
TGF-β ACTATTGCTTCAGCTCCACGGA AGTCAATGTACAGCTGCCGCA
TNF-α GCCCATGTTGTAGCAAACCCT ATGAGGTACAGGCCCTCTGATG
IL-6 AATTCGGTACATCCTCGACGG GTTTGTTTTCTGCCAGTGCCT
CD206 (MR) GTCTTGGGCCACAGGTGAA AAGGCGTTTGGATAGCCACA