Skip to main content

Table 4 List of primers used for qRT-PCR

From: Absence of Apolipoprotein E is associated with exacerbation of prion pathology and promotes microglial neurodegenerative phenotype

Gene Name Forward Primer Sequence (5′–3′) Reverse Primer Sequence (5′–3′)
C3 CGCAACGAACAGGTGGAGATCA CTGGAAGTAGCGATTCTTGGCG
Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
Gfap GGCGCTCAATGCTGGCTTCA TCTGCCTCCAGCCTCAGGTT
P2ry12 CATTGACCGCTACCTGAAGACC GCCTCCTGTTGGTGAGAATCATG
Tmem119 CCTTCACCCAGAGCTGGTTC GGCTACATCCTCCAGGAAGG
Trem2 CTACCAGTGTCAGAGTCTCCGA CCTCGAAACTCGATGACTCCTC