Skip to main content

Table 1 Primers for RT-qPCR

From: In vivo RyR1 reduction in muscle triggers a core-like myopathy

Target gene Forward Reverse
ACTB CTAAGGCCAACCGTGAAAAG ACCAGAGGCATACAGGGACA
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG
HPRT CCTAATCATTATGCCGAGGATTTGG CCCATCTCCTTCATGACATCTCGAG
RYR-1 GGTCTGATTATTGATGCTTTTGGGG TGGTCTCCATGTCTTCCTTCACTTG