Skip to main content

Table 2 Primer sequences

From: Characterising cellular and molecular features of human peripheral nerve degeneration

GeneForward SequenceReverse Sequence
SOX10AGGCTGCTGAACGAAAGTGACAAGACTTGTAGTCCGGGTGGTCTTTCT
c-JunTCCAAGTGCCGAAAAAGGAAGCGAGTTCTGAGCTTTCAAGGT
p75NTRTGAACGACCCCAACAATGTGGGGCTTTTGCTGATACGCTCG
EGR2TCTTCCCAATGATCCCAGACTTTACGGATTGTAGAGAGTGGAGT
18S (Housekeeping gene)CGCGGTTCTATTTTGTTGGTCGGTCCAAGAATTTCACCTC
  1. A table to show the sequences of forward and reverse primers used in the RT-qPCR assays