Skip to main content

Table 1 List of primers

From: Glycine-alanine dipeptide repeats spread rapidly in a repeat length- and age-dependent manner in the fly brain

Primer namePrimer sequencePurpose
JOL14CCCCGGTACCTCACTTGTACAGCTCGTCCATGGeneration of pUAS T-mCherry-C and mCherry-only pUAST plasmids
JOL26ATATGAATTCGGATCCCACCATGGeneration of GA36-mCherry, GR36-mCherry, PR36-mCherry, GA100-mCherry, GR100-mCherry and PR100-mCherry, GA200 and GA200-mCherry plasmids
JOL33AAGCGGCCGCTGAAGCGGeneration of GA36-mCherry plasmid
JOL34AAGCGGCCGCTGATCTGCGeneration of GR36-mCherry plasmid
JOL35AAGCGGCCGCTGATCTGGGeneration of PR36-mCherry plasmid
JOL28AAAAGCGGCCGCTGATGCTCGeneration of GA100-mCherry plasmid
JOL30AAAAGCGGCCGCTGAACGTCGeneration of GR100-mCherry plasmid
JOL34AAAAGCGGCCGCTGATCGAGGeneration of PR100-mCherry plasmid
JOL69CCGCGGCCGCTCTAGACCCGGGTGATGCTCCTGCTCCGeneration of the GA200 and GA200-mCherry plasmids
JOL43GAATTCGGATCCCACCATGTCTAGAGGAGCTGeneration of the GA200 and GA200-mCherry plasmids
JOL44CTTGCGGCCGCTTATGCTCCGeneration of the GA200 and GA200-mCherry plasmids
JOL28AAAAGCGGCCGCTGATGCTCGeneration of the GA200 and GA200-mCherry plasmids