Skip to main content

Table 3 Primer sequences used for qPCR

From: Regulation of microglial TMEM119 and P2RY12 immunoreactivity in multiple sclerosis white and grey matter lesions is dependent on their inflammatory environment

PrimerPrimer sequence forward (5′- 3′)Primer sequence reverse (3′-5′)
TMEM119TCCAGGGTCAGATTACAAGAGCACACTGTTGATTCTGGAGGGTTTGA
P2RY12ACTCTCTCTTCCAGCCCAGGTCCAGGACCAGTTCCTTGGCGTA
AIF-1CCCTCCAAACTGGAAGGCTTCACTTTAGCTCTAGGTGAGTCTTGG
GFAPGCAGATTCGAGAAACCAGCCGCTCCTGCTTGGACTCCTTA
IL-1βTACAGCTGGAGAGTGTAGATCCAAATTCCAGCTTGTTATTG
MRCAGTGATGGGACCCCTGTAACGCCCAGTACCCATCCTTGCCTTT
SDHAaCCAGGGAAGACTACAAGGTGCGGAAGGGTGTGCTTCCTCCAGTGCT
POLR2FaGAACTCAAGGCCCGAAAGTGATGATGAGCTCGTCCAC
  1. a selected as housekeeping gene