Skip to main content

Table 3 Primer sequences used for qPCR

From: Regulation of microglial TMEM119 and P2RY12 immunoreactivity in multiple sclerosis white and grey matter lesions is dependent on their inflammatory environment

Primer Primer sequence forward (5′- 3′) Primer sequence reverse (3′-5′)
TMEM119 TCCAGGGTCAGATTACAAGAGCAC ACTGTTGATTCTGGAGGGTTTGA
P2RY12 ACTCTCTCTTCCAGCCCAGGT CCAGGACCAGTTCCTTGGCGTA
AIF-1 CCCTCCAAACTGGAAGGCTTCA CTTTAGCTCTAGGTGAGTCTTGG
GFAP GCAGATTCGAGAAACCAGCC GCTCCTGCTTGGACTCCTTA
IL-1β TACAGCTGGAGAGTGTAGATC CAAATTCCAGCTTGTTATTG
MRC AGTGATGGGACCCCTGTAACG CCCAGTACCCATCCTTGCCTTT
SDHAa CCAGGGAAGACTACAAGGTGCGGA AGGGTGTGCTTCCTCCAGTGCT
POLR2Fa GAACTCAAGGCCCGAAAG TGATGATGAGCTCGTCCAC
  1. a selected as housekeeping gene