Skip to main content

Table 3 qPCR primers

From: Aldehyde dehydrogenase 2 activity and aldehydic load contribute to neuroinflammation and Alzheimer’s disease related pathology

GENE NAMEFORWARDREVERSE
Iba-1GTCCTTGAAGCGAATGCTGGCATTCTCAAGATGGCAGATC
CD-68CCTTGTTCTCTTTGATGCAGGTGATGACAACTAGGATCTT
CCL-2TTTTGTCACCAAGCTCAAGAGAATTAAGGCATCACAGTCCGAGT
CCL-4AAACCTAACCCCGAGCAACACCATTGGTGCTGAGAACCCT
GFAPTCCTGGAACAGCAAAACAAGCAGCCTCAGGTTGGTTTCAT
iNOSAGGAACCTACCAGCTCACTCTGTTTCCTGTGCTGTGCTACAGTT
COX-2CCACTTCAAGGGAGTCTGGAAGTCATCTGCTACGGGAGGA
IL-1βGCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCCAACT
IL-1αCAAGATGGCCAAAGTTCGTGACGTCTCATGAAGTGAGCCATAGC
NLRP-3AGAAGAGACCACGGCAGAAGCCTTGGACCAGGTTCAGTGT
BADGAGGAGGAGCTTAGCCCTTTAGGAACCCTCAAACTCATCG
BAXTAGCAAACTGGTGCTCAAGGTCTTGGATCCAGACAAGCAG
BIMCGACAGTCTCAGGAGGAACCCCTTCTCCATACCAGACGGA
PUMAGAGCGGCGGAGACAAGAAGAGTCCCATGAAGAGATTGTACATGA
p53ACAGTCGGATATGAGCATCGCCATGGAATTAGGTGACCCT
LC3GATGTCCGACTTATTCGAGAGCTTGAGCTGTAAGCGCCTTCTA
BECLINAGCTGCCGTTATACTGTTCTGACTGCCTCCTGTGTCTTCAATCT
p62GAGGCACCCCGAAACATGGACTTATAGCGAGTTCCCACCA
TIMM10GAAGCTCCGTTGCAGTACAGTCTTGGCAGGACTCGGGAT
ADAMAAGGTTGGCTTGACCTGCTCACCACTCCCAGTTCCTGTT
SHMT2AGTCTATGCCCTATAAGCTCAACCCGCCGGAAAAGTCGAGCAGT
PDK4GAGGATTACTGACCGCCTCTTTAGTTCCGGGAATTGTCCATCAC
POLGCAGCCTGACCCATAGCCATAATTCTCCTTCTGTCAGGTCGAA
PCG-1αCTCCA TGCCTGACGGCACCCGCAGGGACGTCTTTGTGGCT
NRF2CCTCGCTGGAAAAAGAAGTGGGAGAGGATGCTGCTGAAAG
TFAMGCTTCCAGGAGGCTAAGGATCCCAATCCCAATGACAACTC
GAPDHATGACATCAAGAAGGTGGTGCATACCAGGAAATGAGSCTTG
β-actinATGGATGACGATATCGCTATGAGGTAGTCTGTCAGGT