Skip to main content

Table 2 Primers used for real-time PCR

From: Retinal pathology in experimental optic neuritis is characterized by retrograde degeneration and gliosis

Gene Forward (5′-3′) Reverse (5′-3′) Product (bp)
Actb CAACGGCTCCGGCATGTGC CTCTTGCTCTGGGCCTCG 153
Pou4f1 (Brn3a) CGCCGCTGCAGAGCAACCTCTT TGGTACGTGGCGTCCGGCTT 130
Bdnf CAAAGCCACAATGTTCCACCAG GATGTCGTCGTCAGACCTCTCG 213
Casp1 GGCAGGAATTCTGGAGCTTCAA GTCAGTCCTGGAAATGTGCC 138
Mcp1 (Ccl2) GGCTCAGCCAGATGCAGTTA CTGCTGCTGGTGATCCTCTT 108
Gfap CCACCAAACTGGCTGATGTCTAC TTCTCTCCAAATCCACACGAGC 240
Il1b ACTACAGGCTCCGAGATGA CGTTGCTTGGTTCTCCTTG 141
Tnf CCACGCTCTTCTGTCTACTGA GGCCATAGAACTGATGAGAGG 92
Aqp4 TACTGGAGCCAGCATGAATC CCACATCAGGACAGAAGACA 149
Rlbp1 (Cralbp) CCTTTCCAGTCGGGACAAGTATG GGGTTTCCTCATTTTCCAGCAG 140