Skip to main content

Table 1 Oligonucleotide sequence information

From: Quantitative analysis of human endogenous retrovirus-K transcripts in postmortem premotor cortex fails to confirm elevated expression of HERV-K RNA in amyotrophic lateral sclerosis

Primer name Sequence 5′-3’ Reference
HERV-K gag forwarda AGCAGGTCAGGTGCCTGTAACATT Li et al., [19]
HERV-K gag reverse TGGTGCCGTAGGATTAAGTCTCCT Li et al., [19]
HERV-K pol forward TCACATGGAAACAGGCAAAA Li et al., [19]
HERV-K pol reverse AGGTACATGCGTGACATCCA Li et al., [19]
HERV-K env forward CTGAGGCAATTGCAGGAGTT Li et al., [19]
HERV-K env reverse GCTGTCTCTTCGGAGCTGTT Li et al., [19]
GAPDH forward TGCACCACCAACTGCTTAGC Li et al., [19]
GAPDH reverse GGCATGGACTGTGGTCATGAG Li et al., [19]
XPNPEP1 forward Qiagen cat no. QT00051471 Qiagena
XPNPEP1 reverse Qiagen cat no. QT00051471 Qiagena
HERV-W env forward GTATGTCTGATGGGGGTGGAG Levet et al., [18]
HERV-W env reverse CTAGTCCTTTGTAGGGGCTAGAG Levet et al., [18]
  1. aAll primers were synthesised by Eurofins Genomics (Germany) apart from the XPNPEP1 primers which were obtained from Qiagen (Hs_XPNPEP1_1_SG QuantiTect Primer. Product number: 249900. Cat no: QT00051471)