Skip to main content

Table 2 Quantitative RT-PCR primers

From: Comprehensive gene expression meta-analysis identifies signature genes that distinguish microglia from peripheral monocytes/macrophages in health and glioma

GeneForward PrimerReverse Primer
C3TGCCCCTTACCCCTTCATTCCTCCAGCCGTAGGACATTGG
Emilin2GCAGCTTGTGGAACTGCATCTCGGTTGCTTCTGAGGGTTC
F10GGTGAGTGAACCTTGCCCCTGGCACGTTCCCGGTTAATA
F5CACCCGTGATACCTGCGAATTCAGTGCGTTTGGTGAAGGT
FcrlsCTTGTGAGGCTGAAAACGCCGCCATTCACCAAACGCACTT
GdaGACAGCGGCAAAATAGTGTTTCTAGGCCTGGCATGAAGAACTC
Gpr34CCTGGTCTAGGGAGTTTTGGGGAGCAAAGCCAGCTGTCAAC
HpCACTTGGTTCGCTATCGCTGTCCATAGAGCCACCGATGAT
HprtGATTAGCGATGATGAACCAGGTTCCTCCCATCTCCTTCATGACA
Mki67TGGTCACCATCAAGCGGAGAGGCAGCTGGATACGAATGT
Olfml3GCCGACTAGCTGCCTTAGAGCCTCCCTTTCAAGACGGTCC
P2ry12GCACGGACACTTTCCCGTATGCCTTGAGTGTTTCTGTAGGGTA
P2ry13CCTCATCGCTTTCGACAGGTGAACATCAGGGACCAGACGG
SellTCATGGTCACCGCATTCTCGCTTCACGGGAGGACTTGACG
Siglec-HATGTCAGCTGCCCTCATATCCCCTGTACCACATCTGCCAGG
Slc2a5ACAGCTGGCACTTTGAGGAGTTGCCAGAGCAAGGACCAAT
Tmem119CGGTCCTTCACCCAGAGCTCGCAAGTAGCAGCAGAGAC