Skip to main content

Table 3 Bisulfite primers used for DNA methylation analysis

From: Epigenetic control of epilepsy target genes contributes to a cellular memory of epileptogenesis in cultured rat hippocampal neurons

PrimerID Forward primer Reverse primer
Gria2 BB1 TTAGTTGGGTTAGGTGAGGTA TCCCATACACTCACACAATCA
Gria2 BB2 TATAGAGAGATAAAGATAGAGAGAT AATAAATTACCTCATTACATCAAAC
Grin2a BB1 AGGTATTGAGAGGAGTATTTTGG CCACCACACCAACTTAAAACT
Grin2a BB2 AGTGAGTGATAAAAGTAGTTAGTG ATCTCTTCCTAACCTTACCTTAT