Skip to main content

Table 2 Genomic DNA primers used for preamplification and quantitative real-time PCR to amplify immunoprecipitated DNA

From: Epigenetic control of epilepsy target genes contributes to a cellular memory of epileptogenesis in cultured rat hippocampal neurons

PrimerID Forward primer Reverse primer
Gria2 A TGGGAGTCGTCCTTTCAGAGA AAACTGATTTCCGGTTGCTATG
Gria2 B CGCTGTCCTCGGTGCTAAAAT AGAGAGGGGCAGGCAGTCT
Gria2 C TGTGCGCGCTCGTGTGAGA TCCTTATTTCCCAGTTGTAGCT
Grin2a A AGCCAGGGCTCTAGAAGAGA GCGACGAGCCGGGAGAAGA
Grin2a B GTGGAGGTTCCCACTAAGCTT AGGGCGGAGGAGAGATGGA