Skip to main content

Table 1 cDNA primers used for quantitative real-time PCR for gene expression analysis

From: Epigenetic control of epilepsy target genes contributes to a cellular memory of epileptogenesis in cultured rat hippocampal neurons

PrimerID Forward primer Reverse primer
Gria2 ACGAGTACATCGAGCAGAGGAA GATGCCGTAGCCTTTGGAATC
Grin2a TGGCCTCAGTGACAAGAAGTTC AGACGGCTGCGTCATAGATGAA