Skip to main content

Table 1 Primers used to perform site-directed mutagenesis and generate the A53E mutant

From: The effects of the novel A53E alpha-synuclein mutation on its oligomerization and aggregation

A53E forward 5′ GAGTGGTGCATGGTGTGGAAACAGTGGCTGAGAAGAC 3′
A53E reverse 5′ GTCTTCTCAGCCACTGTTTCCACACCATGCACCACTC 3′