Skip to main content

Table 3 qRT-PCR primers

From: The identification of human pituitary adenoma-initiating cells

Gene Forward Primer Reverse Primer
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
Pax7 CTAAGGATGTTGAACGGGCA TTCTCCGTTGGAACTGATGG
Sox2 CTAAGGATGTTGAACGGGCA TTCTCCGTTGGAACTGATGG