Skip to main content

Table 2 Primer sequences

From: Small heat shock proteins are induced during multiple sclerosis lesion development in white but not grey matter

Markers GeneID Sequence forward Sequence reverse Size (bp) Annealing temperature (°C)
HSPB1 3315 ACGGTCAAGACCAAGGATGG AGCGTGTATTTCCGCGTGA 104 58
HSPB6 126393 TGCTAGACGTGAAGCACTTCT ACCACCTTGACAGCAATTTCC 49 64
HSPB8 26353 CTCCTGCCACTACCCAAGC GGCCAAGAGGCTGTCAAGT 123 64
HSPB11 51668 TGATGGCTCCGCTACTTACTT GCAGAAACGCTATGCACAGAT 78 60
EF1α 1915 AAGCTGGAAGATGGCCCTAAA AAGCGACCCAAAGGTGGAT 116 55–62
18S 100008588 GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGCG 150 58–65