Skip to main content

Table 2 Primers and TaqMan probes for KIAA1549-BRAF fusion gene variants

From: Posterior fossa and spinal gangliogliomas form two distinct clinicopathologic and molecular subgroups

Gene fusion Primer TaqMan probe
KIAA1549-BRAF (KIAA exon 13 - BRAF exon 11) forward GGGTCCCCAGTAAGATCCAG ATCGCCATGCAGCCGATCCCGGCACCT
KIAA1549-BRAF (KIAA exon 13 - BRAF exon 11) reverse CTCGAGTCCCGTCTACCAAG  
KIAA1549-BRAF (KIAA exon 15 - BRAF exon 9) forward CGTCCACAACTCAGCCTACATC ACCACAGGTTTGTCTGC
KIAA1549-BRAF (KIAA exon 15 - BRAF exon 9) reverse CCTGGAGATTTCTGTAAGGCTTTC  
KIAA1549-BRAF (KIAA exon 15 - BRAF exon 11) forward AGCGATGGCACCTACAGGA CGTCCACAACTCAGCCTACATCGGATGCCCA
KIAA1549-BRAF (KIAA exon 15 - BRAF exon 11) reverse TCATCACTCGAGTCCCGTCT  
KIAA1549-BRAF (KIAA exon 16 - BRAF exon 9) forward CCAGACGGCCAACAATCC ACCACAGGTTTGTCTGC
KIAA1549-BRAF (KIAA exon 16 - BRAF exon 9) reverse CCTGGAGATTTCTGTAAGGCTTTC  
KIAA1549-BRAF (KIAA exon 16 - BRAF exon 10) forward CAGTGGGGGTCCTTCTACAG AGCCCAGACGGCCAACAATCCCTGCAG
KIAA1549-BRAF (KIAA exon 16 - BRAF exon 10) reverse CTTCCTTTCTCGCTGAGGTC  
KIAA1549-BRAF (KIAA exon 16 - BRAF exon 11) forward AGTGGGGGTCCTTCTACAGC AGCCCAGACGGCCAACAATCCCTGCAG
KIAA1549-BRAF (KIAA exon 16 - BRAF exon 11) reverse CATGCCACTTTCCCTTGTAG  
KIAA1549-BRAF (KIAA exon 17 - BRAF exon 10) forward GAATGACTCCCCCGACG ACCACAGGTTTGTCTGCTACCCCCCCTGC
KIAA1549-BRAF (KIAA exon 17 - BRAF exon 10) reverse AGGCTTTCACGTTAGTTAGTGAGC  
KIAA1549-BRAF (KIAA exon 18 - BRAF exon 10) forward TGCTGCCAGAGGGATCTACTC ACCACAGGTTTGTCTGC
KIAA1549-BRAF (KIAA exon 18 - BRAF exon 10) reverse CCTGGAGATTTCTGTAAGGCTTTC  
KIAA1549-BRAF (KIAA exon 19 - BRAF exon 9) forward CCAGGCTGGCCTTCGTAC ACCACAGGTTTGTCTGC
KIAA1549-BRAF (KIAA exon 19 - BRAF exon 9) reverse CCTGGAGATTTCTGTAAGGCTTTC