Skip to main content

Table 1 Human gene sequences for ApoE, βAPP, α-secretase, BACE 1, BACE 2, IL-1α, IL-1β, and S100B, with PCR annealing temperatures and number of amplification cycles

From: Epilepsy: neuroinflammation, neurodegeneration, and APOE genotype

Gene analyzed Human sequences Annealing temp. (Co) Cycle no.
ApoE F: CCCAGGTCACCCAGGAACT 60 40
  R: AGTTCCGATTTGTAGGCCTTCA   
βAPP F: AACCACCGTGGAGCTCCTT 60 40
  R: ATGCCACGGCTGGAGATC   
α-secretase (ADAM 10) F: AGTGTACGTGTGCCAGTTC 60 40
  R: TTGCAGGGTGATGGTTCG   
BACE 1 F: CAGTCAAATCCATCAAGGCAG 60 40
  R: GTTGGTAACCTCACCCATTAGG   
BACE 2 F: AGAGTATAACGCAGACAAGGC 60 40
  R: CCAGTCCAGAAACCATCAGAG   
IL-1 α F: GGAGAGCATGGTGGTAGTAGCAA 60 40
  R: TGGCTTAAACTCAACCGTCTCTT   
IL-1 β F: GCACGATGCACCTGTACGAT 60 40
  R: CACCAAGCTTTTTTGCTGTGAGT   
S100B F: CCCCAGGGACTCTTGTTAACAG 60 40
  R: CACGGTGCACGCTTTATCAC